ID: 1008593072

View in Genome Browser
Species Human (GRCh38)
Location 6:53013114-53013136
Sequence GCATGTCTTACCTACCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008593072_1008593073 4 Left 1008593072 6:53013114-53013136 CCTGTCTGGTAGGTAAGACATGC 0: 1
1: 1
2: 0
3: 6
4: 110
Right 1008593073 6:53013141-53013163 TAATCTTCCTTTGATAAATGAGG 0: 1
1: 0
2: 4
3: 63
4: 752
1008593072_1008593076 21 Left 1008593072 6:53013114-53013136 CCTGTCTGGTAGGTAAGACATGC 0: 1
1: 1
2: 0
3: 6
4: 110
Right 1008593076 6:53013158-53013180 ATGAGGAAACTGAATCCATAGGG No data
1008593072_1008593075 20 Left 1008593072 6:53013114-53013136 CCTGTCTGGTAGGTAAGACATGC 0: 1
1: 1
2: 0
3: 6
4: 110
Right 1008593075 6:53013157-53013179 AATGAGGAAACTGAATCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008593072 Original CRISPR GCATGTCTTACCTACCAGAC AGG (reversed) Intronic
906853673 1:49281478-49281500 GCATGTCTGAGCAAACAGACAGG - Intronic
911551900 1:99292637-99292659 GCAATTCTTTCCTACCACACTGG + Intronic
916734886 1:167598776-167598798 GTATGTCTTAGCAAACAGACTGG - Intergenic
918570471 1:185985504-185985526 GGATGTCTTTCCTATCAGAGGGG + Intronic
921502617 1:215924042-215924064 TCATGTCTTATCTACTAGATGGG - Intronic
922330357 1:224569710-224569732 CTATTTCATACCTACCAGACTGG - Intronic
923049049 1:230377618-230377640 GCATATCTGACCTACCGAACAGG + Exonic
1064992683 10:21269800-21269822 GGTGGTCTTCCCTACCAGACTGG + Intergenic
1065507812 10:26446926-26446948 GCCTGTCTTTCCCACTAGACTGG - Intronic
1072252379 10:93591638-93591660 GGAAGCCTTACCTACCAGCCTGG - Intronic
1075040155 10:119101730-119101752 TGCTGTCTTACCTGCCAGACAGG - Intergenic
1075920164 10:126204767-126204789 GCTTATCTTACCTACCAAATGGG + Intronic
1077069015 11:659269-659291 GCACCTCTTAGCTACCAGAGAGG + Intronic
1079041897 11:17067047-17067069 GTCTGTCTGCCCTACCAGACTGG - Intergenic
1083488941 11:63000709-63000731 CCATGTCTCACCTGTCAGACAGG + Exonic
1084989507 11:72909729-72909751 GCACTCCTCACCTACCAGACGGG - Intronic
1085799745 11:79578365-79578387 GTATGTCTTATCTAAAAGACTGG + Intergenic
1087152039 11:94867964-94867986 GCATGTCATTCCTGCGAGACAGG - Intronic
1088628363 11:111749777-111749799 GCATGTCACCCCTGCCAGACAGG + Intronic
1090976235 11:131682892-131682914 GCACATTTTACCTACCAGCCGGG + Intronic
1092709891 12:11324891-11324913 GCATTTGTTCCCTACCTGACAGG - Intergenic
1092782398 12:11999252-11999274 GCATGGCTTCCCGACCAGCCAGG + Intergenic
1093759584 12:22892849-22892871 GAATGTCTTATCTACCTGACAGG - Intergenic
1094192450 12:27711082-27711104 CCATGGTTTTCCTACCAGACGGG - Intronic
1097091660 12:56510371-56510393 CCATTTCTCACCTGCCAGACTGG - Intergenic
1099157420 12:79196073-79196095 GTATGTCTTAACTACCTGGCTGG - Intronic
1099260827 12:80380575-80380597 CAATTTCTCACCTACCAGACTGG + Intergenic
1101645823 12:106629974-106629996 GCATTTCTTACTTATCAGATTGG - Intronic
1107534391 13:41313655-41313677 GCATGTCTTATTCCCCAGACTGG + Intronic
1108713240 13:53054763-53054785 GCATCTCTTACCCACGAGCCAGG - Intergenic
1110341346 13:74394541-74394563 CCATTTCTCACCTATCAGACTGG - Intergenic
1111865163 13:93759107-93759129 GTCTGTCTTACCTCCCAGAGAGG + Intronic
1111938523 13:94583997-94584019 CCACTTCTTACTTACCAGACTGG + Intronic
1121218233 14:92264882-92264904 GCATGTCTTACCCACCAGACTGG - Intergenic
1127554672 15:60076116-60076138 GCCTGTCTGACCCACCAGTCTGG + Intergenic
1134326102 16:13209326-13209348 GTATGTCTTTCCCATCAGACTGG - Intronic
1137232175 16:46576848-46576870 CCATGCCTTACCTAGAAGACTGG - Intergenic
1139324837 16:66144591-66144613 GCATCTCTGTCCTGCCAGACTGG + Intergenic
1140072691 16:71665406-71665428 CCATGTTTTATCTACTAGACTGG - Intronic
1141929827 16:87194874-87194896 GCATTTCTCACCTATCAGACTGG - Intronic
1148028822 17:44606281-44606303 GACTGTCTTCCCTACTAGACTGG + Intergenic
1150171738 17:63003510-63003532 GGATGTTTTACCTCCCAGGCAGG + Intergenic
1155405601 18:25483557-25483579 CCATTTCTTACCTCCAAGACGGG + Intergenic
1156697015 18:39779448-39779470 GCTTTTCTTCCCTACCAGTCTGG + Intergenic
1160094871 18:75862113-75862135 GCATGCCTTATCTACCACAGGGG - Intergenic
1166652629 19:44586044-44586066 GCATGTTTTTCCAACCAGTCTGG - Intergenic
925352861 2:3214296-3214318 ACAGCTCTTACCTACCAGCCTGG - Intronic
925757990 2:7152452-7152474 GCTTTTCCTACCTGCCAGACTGG + Intergenic
926154085 2:10441494-10441516 GCATGGCTTACTTACCACGCAGG + Exonic
927834366 2:26380814-26380836 TCATTTCTTACCTATCAGATTGG - Intronic
928894750 2:36247782-36247804 CCATTTCTTACCTGTCAGACTGG + Intergenic
930324942 2:49903783-49903805 GAATGTCTTACTTAGCATACTGG - Intergenic
938140441 2:128790585-128790607 GCATGTCTTCCCTGCCTCACTGG + Intergenic
941985643 2:171509008-171509030 AAATGTATTACCTACGAGACAGG + Intergenic
943532757 2:189105395-189105417 TCATGTTTTACCTATCAGATTGG - Intronic
945840114 2:214877473-214877495 CCACTTCTTACCTACCAGATAGG - Intergenic
946122186 2:217525845-217525867 GCATGTCATACCTCCCAGGCTGG + Intronic
948126490 2:235567978-235568000 GCATTTCTTACATACCAGCAAGG - Intronic
1169420106 20:5452796-5452818 GCATTCCTCACCTCCCAGACGGG - Intergenic
1169420298 20:5453476-5453498 GCATTCCTCACCTCCCAGACGGG - Intergenic
1183787458 22:40038442-40038464 GACTGTCTCACCCACCAGACAGG - Exonic
1185307632 22:50129726-50129748 GCATTACACACCTACCAGACTGG - Intronic
949799932 3:7892636-7892658 GAATGTTTTACCTAGCAGCCTGG + Intergenic
959470749 3:106747107-106747129 GCATGTCTTACCTTCAGGAAAGG + Intergenic
962377742 3:134872794-134872816 GTATGCCTCCCCTACCAGACTGG + Intronic
963063639 3:141245012-141245034 GCATTTCTTACCTTTCAGATTGG - Intronic
965902277 3:173656958-173656980 TTTTGTCTTACCTACCAGAAAGG + Intronic
970169868 4:13278792-13278814 GCATCTCTTACCCTCCAGCCAGG + Intergenic
970396727 4:15675478-15675500 TCAAGTCTTAGCTACCACACAGG + Intronic
971328166 4:25661343-25661365 GCGTGTTTTACCTACCACCCAGG - Intronic
974184583 4:58430095-58430117 ACATGTCTTACCTACCCTAGGGG - Intergenic
980099079 4:128523297-128523319 GCCTGTCTTCCCTACTAGAATGG + Intergenic
985433266 4:189901922-189901944 GCATGTCTTACCAAGCATAGGGG + Intergenic
995179371 5:109216120-109216142 CCATTTCTTACCTAACAGATTGG + Intergenic
995922801 5:117333865-117333887 GCATTTCTAACCTAGCTGACAGG + Intergenic
997149456 5:131477201-131477223 AGCTGTCTTACCTATCAGACTGG - Intronic
997635949 5:135405867-135405889 CCATTTCTTACTTACCAGACTGG + Intergenic
997842479 5:137254809-137254831 GAATGTCTAACCAACAAGACTGG + Intronic
1000161488 5:158601861-158601883 GCGTAGCTTACCTTCCAGACGGG + Intergenic
1002136025 5:177108143-177108165 TCACTTCCTACCTACCAGACTGG + Intergenic
1005019114 6:21400961-21400983 GCACCTCCTACCTAGCAGACTGG - Intergenic
1007298142 6:40844355-40844377 TCCTGTCTTCCCTACCAGCCTGG - Intergenic
1007416173 6:41692557-41692579 CCCTGTCTTTCCTTCCAGACTGG - Intronic
1008524671 6:52396234-52396256 GCTTTTCTTAACTCCCAGACTGG - Intronic
1008593072 6:53013114-53013136 GCATGTCTTACCTACCAGACAGG - Intronic
1013838229 6:114358413-114358435 ACATGTTTTACCAATCAGACAGG - Intergenic
1015569678 6:134608034-134608056 GCATGTCCTACCTACATGGCTGG + Intergenic
1019611148 7:1937296-1937318 CCATCTCTTCCCTACCAGCCTGG + Intronic
1019929168 7:4211998-4212020 GCACGTCTTTCCCACCACACTGG + Intronic
1020379279 7:7525244-7525266 GCATGTCATATGTACCATACAGG + Intronic
1023680861 7:42685817-42685839 GCACGTCTTTTCTACTAGACCGG - Intergenic
1023683320 7:42711133-42711155 GCATGTCTGTCCCACCTGACTGG + Intergenic
1029051380 7:97692460-97692482 ACATGTCTTACATGGCAGACAGG - Intergenic
1029235257 7:99110545-99110567 CCATCTCTCACCTATCAGACTGG + Intronic
1029623519 7:101705244-101705266 CCATTTCTTACCTATCAGATAGG + Intergenic
1032080220 7:128854942-128854964 GCCTGCCTGACCTTCCAGACTGG + Intronic
1035571841 8:677561-677583 GCAGGTCTGACCAACCAGCCTGG + Intronic
1037017474 8:13926167-13926189 AAATGTCTTACATGCCAGACTGG + Intergenic
1041115179 8:54528496-54528518 CTATTTCTTACCTACCAGATAGG + Intergenic
1041216816 8:55608867-55608889 GCATGTCTTACATAGCTGGCAGG + Intergenic
1048334765 8:133494212-133494234 GCATGTCTTACCTGCAAAATAGG - Intronic
1048405695 8:134118001-134118023 GCATGTCTTACATGGCAGCCAGG + Intergenic
1048549673 8:135422508-135422530 GCATGTATATCCTACCAGACAGG - Intergenic
1048578291 8:135710020-135710042 GTCTGCCTTACCTAGCAGACTGG + Intergenic
1048586045 8:135775227-135775249 GTATCTCTCTCCTACCAGACTGG - Intergenic
1053425668 9:38008439-38008461 GAATGACTTACCTACCGGACAGG - Intronic
1058762871 9:108152437-108152459 ACATGTTATACCAACCAGACAGG + Intergenic
1058910505 9:109516370-109516392 GCTTCTCTAACCCACCAGACAGG - Intergenic
1059991347 9:119869191-119869213 GCCTGTTTTCCCCACCAGACTGG - Intergenic
1061637677 9:131924265-131924287 CCATTTCTCACCTACCAGATTGG - Intronic
1186401763 X:9266901-9266923 GCCAGTCTTACATACCATACTGG + Intergenic
1186794964 X:13037666-13037688 GAATATCTTACCTCCCAGAAGGG + Exonic
1189514932 X:41703887-41703909 CCATTTCATACCTACCAGATTGG - Intronic
1190409202 X:50117969-50117991 CCATTTGTTACCTACCAGAATGG + Intergenic
1194376337 X:93137803-93137825 TAATGTCTCACCTTCCAGACAGG - Intergenic
1198492993 X:137162504-137162526 GGCTGTCTTACTTACCAAACTGG - Intergenic
1199333674 X:146592160-146592182 GCATTTTTTACCTATCAGATTGG - Intergenic
1200527788 Y:4295612-4295634 GCACTTCTTACATCCCAGACGGG - Intergenic