ID: 1008594963

View in Genome Browser
Species Human (GRCh38)
Location 6:53032941-53032963
Sequence TTCCATCATCTGGAGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008594963_1008594973 3 Left 1008594963 6:53032941-53032963 CCCACCCCCTCCAGATGATGGAA 0: 1
1: 0
2: 3
3: 31
4: 185
Right 1008594973 6:53032967-53032989 AGGCTGTGGAAGAAGCCAGAGGG No data
1008594963_1008594974 4 Left 1008594963 6:53032941-53032963 CCCACCCCCTCCAGATGATGGAA 0: 1
1: 0
2: 3
3: 31
4: 185
Right 1008594974 6:53032968-53032990 GGCTGTGGAAGAAGCCAGAGGGG No data
1008594963_1008594972 2 Left 1008594963 6:53032941-53032963 CCCACCCCCTCCAGATGATGGAA 0: 1
1: 0
2: 3
3: 31
4: 185
Right 1008594972 6:53032966-53032988 CAGGCTGTGGAAGAAGCCAGAGG 0: 1
1: 0
2: 2
3: 70
4: 560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008594963 Original CRISPR TTCCATCATCTGGAGGGGGT GGG (reversed) Intronic
900532059 1:3159347-3159369 CTCCACCATCTGGAGGTGGGAGG + Intronic
902140325 1:14348301-14348323 TTCCAGCATTTGGAGAGGCTGGG - Intergenic
902292088 1:15442205-15442227 TTCCCTCATCTGTAAGGGGGAGG - Intronic
903071467 1:20728921-20728943 TTTCATGATCTGCAAGGGGTTGG - Intronic
903303184 1:22393344-22393366 TTCCTTCTCCAGGAGGGGGTAGG + Intergenic
905645888 1:39624990-39625012 TTCCATCAAAGGGAGGAGGTGGG + Exonic
907409565 1:54274722-54274744 TTCCATGGCCTGGAGGGGCTGGG - Intronic
909918143 1:81346631-81346653 TGCCATCATATGGAGGGGTAGGG - Intronic
913218388 1:116639473-116639495 TTCTGTCATCTGCAGGTGGTTGG - Intronic
916941303 1:169681351-169681373 ATCCAGCATCTGGAAGGGGAGGG - Intronic
917169671 1:172157164-172157186 TTCCATCATCTGGGGATGATGGG + Intronic
922858350 1:228794455-228794477 TTCCATCTTCTGGTGGTTGTTGG + Intergenic
923405553 1:233655572-233655594 TACCATCACCTTGAGAGGGTGGG - Intronic
923694696 1:236236260-236236282 TTCAAGTAACTGGAGGGGGTGGG - Exonic
1066434176 10:35381442-35381464 TCCCAGCTACTGGAGGGGGTGGG + Intronic
1067082849 10:43221424-43221446 TTCCTTCATCTGGAGAAGGGGGG - Intronic
1069049634 10:63778939-63778961 TTCCATAATGGGGTGGGGGTGGG - Intergenic
1069328373 10:67260148-67260170 AGCCATCATCTGGAGGGAGTGGG + Intronic
1073161423 10:101400067-101400089 TTCCATAAACTGGATGGGGAGGG + Intronic
1073219330 10:101856855-101856877 TCCCATAATGTGGAGGGGGCTGG + Intronic
1074982165 10:118628321-118628343 TTCCATCTTGGGGAGGGGGGAGG + Intergenic
1076381056 10:130024663-130024685 TTCCATCATCTGCAGGAGACGGG - Intergenic
1077602221 11:3581558-3581580 TTCCATGATTTGGAGGTGGTGGG + Intergenic
1078092865 11:8278115-8278137 TTCCATCATGGGGCAGGGGTGGG - Intergenic
1078155778 11:8798738-8798760 GTCCTGCAACTGGAGGGGGTAGG + Intronic
1084258122 11:67956108-67956130 TTGCATGATTTGGAGGTGGTGGG + Intergenic
1084814628 11:71639106-71639128 TTGCATGATTTGGAGGTGGTGGG - Intergenic
1084903729 11:72329779-72329801 TTCATTCCTCTGCAGGGGGTTGG + Exonic
1085930423 11:81076174-81076196 TTCTTTTATCTGGTGGGGGTAGG - Intergenic
1086579149 11:88376655-88376677 TTCCAGCAACTGGAGGGGTCAGG + Intergenic
1087117170 11:94537833-94537855 TTCCTCCATCTGGAGAGAGTTGG + Intergenic
1088343010 11:108790170-108790192 TTACATCATCTGGAGTAGGGCGG - Intronic
1090086146 11:123653005-123653027 TTCCCTTATTTGGAGGGGGAAGG + Intronic
1090770647 11:129916749-129916771 TTCTATAAGGTGGAGGGGGTTGG - Intronic
1091856458 12:3744545-3744567 TTTCCTCATCTGGAAAGGGTGGG + Intronic
1092428362 12:8390910-8390932 TTCCATGATTTGGAGGTGGTAGG + Intergenic
1092429445 12:8397061-8397083 TTCCATGATTTGGAGGTGGTGGG + Intergenic
1093594198 12:20941865-20941887 GTCCACTGTCTGGAGGGGGTTGG - Intergenic
1096084702 12:48857725-48857747 TTCCTTCCTCTGGAGCGGGGGGG + Exonic
1096222666 12:49841793-49841815 GTCCAGCATCTGGAGGGCGGGGG - Intronic
1098787899 12:74782381-74782403 TGCAATCAGCTGCAGGGGGTTGG + Intergenic
1100010576 12:89947920-89947942 TTCCTTCATCTGTAGAGTGTGGG - Intergenic
1100185850 12:92138677-92138699 TTCCAACAACTGGATGAGGTTGG - Intronic
1100296264 12:93264871-93264893 TTCCAGATTCTGGAGGGGTTAGG - Intergenic
1100942942 12:99744102-99744124 TTTCAGTATCTGCAGGGGGTTGG - Intronic
1101818300 12:108162696-108162718 CTCCATTTTCTGGAGGGGCTGGG + Intronic
1102021391 12:109685884-109685906 TTGGATCATCTGGAGGGTGGAGG + Intergenic
1102555883 12:113726161-113726183 ATGCCTCATGTGGAGGGGGTGGG - Intergenic
1102983244 12:117258970-117258992 TTCCATCATCAGGAAGAAGTAGG - Intronic
1103351572 12:120287395-120287417 TTCCATCCTCTGGAGCCAGTGGG + Intergenic
1103991104 12:124800092-124800114 TGCCATCCTCTGTGGGGGGTGGG - Intronic
1108003841 13:45928097-45928119 TTCTCTCATCTGGTGGAGGTAGG - Intergenic
1112810910 13:103217448-103217470 TTCAACCATCAGGATGGGGTGGG - Intergenic
1116442026 14:44964199-44964221 TGCCATCTTCTGCCGGGGGTAGG + Exonic
1120169452 14:81234282-81234304 TTGCTTCAGCTGGAGGGGGAGGG + Intergenic
1121533413 14:94674149-94674171 TTCACTCCTCTGGTGGGGGTGGG - Intergenic
1122647530 14:103205331-103205353 TACAATCACATGGAGGGGGTTGG + Intergenic
1124818212 15:33018100-33018122 TACCATCACCTTAAGGGGGTAGG - Intronic
1129153884 15:73705527-73705549 TTCCATCTTGGGGAAGGGGTGGG - Intronic
1130176471 15:81576857-81576879 TTCCATCATTTGCAGGGGCAAGG - Intergenic
1130332314 15:82932105-82932127 TTCCATAATATGGATGGAGTTGG - Intronic
1134080763 16:11323469-11323491 TTCCATCTTCTGGAGGAAGCAGG + Intronic
1135666632 16:24341029-24341051 TTCCATCTTCTACAGTGGGTGGG + Intronic
1136042057 16:27587308-27587330 TTCCATCAGCTGGAGTAGCTGGG + Intronic
1137339036 16:47581297-47581319 ATCCATCCTCTAGAGGGAGTTGG - Intronic
1138435029 16:56993578-56993600 TCCCACCAGCTGGAGGGGGAGGG + Intronic
1138890966 16:61143722-61143744 TCCCATTATCAGGAGGGGGTAGG - Intergenic
1141155396 16:81593477-81593499 ATCCATCATGTGGAGCTGGTCGG + Intronic
1141164253 16:81649897-81649919 ATTCATCCTCTGGAGCGGGTAGG + Intronic
1141790819 16:86232846-86232868 TTCTATCATCTGGTTGGGGTTGG - Intergenic
1144533160 17:16059819-16059841 TTCCATGACCTGGTGGGGATAGG - Intronic
1144679280 17:17182172-17182194 TTCCATCTTCTTGAAGGGTTGGG - Intronic
1144796894 17:17897795-17897817 TTTCATCATCTGTACGGGGGAGG + Intronic
1145822277 17:27848115-27848137 TTCCATGCTTTGGAGGGGGTGGG - Intronic
1146127361 17:30239579-30239601 TTGCTTCATCTGGATGGGGTGGG - Intergenic
1146593682 17:34151308-34151330 TCACCTCATCTGGAGGGGGTGGG + Intronic
1147942709 17:44060857-44060879 TGCCACCATTTAGAGGGGGTGGG - Intronic
1149205096 17:54234751-54234773 TACCATCACCTTGAGGGGGTAGG - Intergenic
1151331823 17:73414586-73414608 TAAGATCTTCTGGAGGGGGTGGG - Intronic
1152105232 17:78324783-78324805 TTTGTTGATCTGGAGGGGGTCGG + Intergenic
1155003547 18:21708091-21708113 TACCATCACCTTGAGGGGCTAGG + Intronic
1155479367 18:26268686-26268708 TCCCATCATCTGGAGGAGGTAGG - Intronic
1156019220 18:32580622-32580644 TTCCAACATTTGGAGAGGATGGG - Intergenic
1157112881 18:44837561-44837583 TTGCATCACATGGATGGGGTGGG + Intronic
1157389463 18:47289054-47289076 TTTCCTCATCTGGAAGGAGTGGG - Intergenic
1158402586 18:57134266-57134288 TTCCATCAAGAGCAGGGGGTGGG + Intergenic
1158890907 18:61870969-61870991 TGCCATTATCAGGATGGGGTCGG - Intronic
1159595407 18:70378251-70378273 TACCATCACCTTGAGGGGTTAGG + Intergenic
1160262597 18:77308785-77308807 TTCCATCATGGAGAGAGGGTAGG + Intergenic
1161039717 19:2103723-2103745 TTCCATCCTGTGGAGGACGTGGG - Intronic
1162822488 19:13231448-13231470 TGCCAGCATCTGGTGGGGGGAGG + Intronic
1165929998 19:39351309-39351331 TTCCCACCTCTGGAGGTGGTAGG + Intronic
1167674682 19:50877024-50877046 TCCCAACATCTGGAGGGGAAAGG + Intronic
1168671187 19:58242635-58242657 TCCCAGCAACTGGTGGGGGTAGG - Intronic
926086341 2:10022595-10022617 CTCAATCATGTGGCGGGGGTAGG + Intergenic
926163085 2:10501804-10501826 TTCCACCACGTGGTGGGGGTGGG - Intergenic
927265001 2:21136526-21136548 TTCCCTCATTTTGAGGGGGAAGG + Intronic
934066600 2:88347496-88347518 TAGCATCATCTGGAGGGGTTGGG + Intergenic
936017924 2:108973590-108973612 TTCCCTCATCTGCAGGGTGCTGG + Intronic
939069086 2:137518038-137518060 TTCCATCAAATGGAAGTGGTTGG + Intronic
939666760 2:144962581-144962603 TTACATCAGCTGGATGAGGTGGG - Intergenic
941670121 2:168284040-168284062 TTCCAGCAGCTGCAGGGGGAGGG - Intergenic
942146496 2:173032238-173032260 TTCCAGCATCTGGTGGGGAGAGG - Intronic
943432772 2:187825324-187825346 TTCCATGGTCAGGAGGCGGTGGG - Intergenic
943765266 2:191654218-191654240 CTCCATCAGCTGGGCGGGGTGGG + Intergenic
944159193 2:196640821-196640843 TTCCACCATTTGGAGTGGGAGGG + Intronic
946145418 2:217726909-217726931 TACCATCATCTTGGGGGGTTAGG + Intronic
947134300 2:226961722-226961744 TATCATCATCTGGATGGGGGTGG - Intronic
1168747326 20:254690-254712 TTCCATGGTCGGAAGGGGGTGGG + Intergenic
1170380706 20:15756688-15756710 TTTTATCATCTGAAGGGGGAAGG + Intronic
1170518955 20:17163231-17163253 TTCCACAATCTGCAGAGGGTTGG - Intergenic
1174213326 20:48897341-48897363 TACCAGGGTCTGGAGGGGGTGGG - Intergenic
1175052304 20:56166896-56166918 TTCCATGGACTGGAGGAGGTGGG - Intergenic
1179443093 21:41409687-41409709 TTCCAGCCTCTGGAGGTGGGAGG - Intergenic
1179898095 21:44374560-44374582 TCCCATCATCTGGGGGTGATGGG + Intronic
1180819689 22:18817553-18817575 TTCTGTCATCTGCAGGTGGTTGG - Intergenic
1181043431 22:20203636-20203658 GACCCTCATCTGGAGGGGCTGGG + Intergenic
1181205914 22:21251998-21252020 TTCTGTCATCTGCAGGTGGTTGG - Intergenic
1182121578 22:27790664-27790686 TTCCCACAACTGGTGGGGGTAGG + Intronic
1182550240 22:31096984-31097006 TGCCATCATCTGCAGGGGCAGGG - Exonic
1183266568 22:36830220-36830242 TCCCACCATCTGGAGGTGGAGGG - Intergenic
1184237224 22:43189448-43189470 TTCAATTGTCTGGAGGGGGAGGG - Intergenic
1184581690 22:45422332-45422354 TTCCAGCTTCTGGAGGTGCTTGG - Exonic
1184712194 22:46258243-46258265 TTTCATCTTCTGTAAGGGGTTGG + Exonic
1203221007 22_KI270731v1_random:43415-43437 TTCTGTCATCTGCAGGTGGTTGG + Intergenic
1203269818 22_KI270734v1_random:43406-43428 TTCTGTCATCTGCAGGTGGTTGG - Intergenic
952764518 3:36943485-36943507 TTGCATCCTCTGCGGGGGGTGGG - Intronic
953035817 3:39209896-39209918 TACCATCACTTGGAGGGGGTGGG + Intergenic
954588019 3:51753739-51753761 TTGCTTCAGCTGGAGGGGGAGGG + Intergenic
954691207 3:52396604-52396626 CTCCATCACCTGGGGGAGGTGGG - Exonic
959692687 3:109216793-109216815 TTCCATCATCTAGTGGGAGGAGG - Intergenic
961281017 3:125766156-125766178 TTCCATGATTTGGAGGTGGTGGG - Intergenic
961873375 3:130003429-130003451 TTCCATGATTTGGAGGTGGTGGG + Intergenic
966867482 3:184267201-184267223 TTCCATCAGGTGGATAGGGTAGG - Intronic
967154113 3:186677196-186677218 CTCTTTCATCTGGAGGAGGTGGG - Exonic
967941444 3:194769392-194769414 ATCCATCATCTACAAGGGGTGGG - Intergenic
967947201 3:194813468-194813490 TTCCATCATCTGGAAAGGAAAGG + Intergenic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
969016669 4:4107918-4107940 TTGCATGATTTGGAGGTGGTGGG + Intergenic
969737288 4:9000397-9000419 TTGCATGATTTGGAGGTGGTGGG - Intergenic
969796491 4:9531985-9532007 TTGCATGATTTGGAGGTGGTGGG - Intergenic
971565811 4:28139667-28139689 TTCCATCCTCTGTGTGGGGTTGG - Intergenic
974769203 4:66388704-66388726 TTCTTTCCTTTGGAGGGGGTGGG - Intergenic
978514927 4:109559863-109559885 GTCCGGCATCTGGAGGGGGCAGG - Intergenic
979348638 4:119620006-119620028 TTCCATCACATGGATGGGGGTGG + Intronic
979564071 4:122134392-122134414 TTCCATCATGTGGAGCTGATAGG + Intergenic
979746574 4:124221688-124221710 TTCCACCTTCTGGTGGGGGTTGG - Intergenic
980082993 4:128363925-128363947 TACCATCACCTGGGGGGGTTAGG + Intergenic
982788062 4:159559131-159559153 TTCCATTATCTGGAAGCAGTTGG - Intergenic
986002842 5:3643523-3643545 CTTCAGCATCTGGAGGGGGCAGG - Intergenic
990990169 5:61676234-61676256 TTCCATCACATGGGGTGGGTGGG + Intronic
992115488 5:73534847-73534869 TTCCATCAGCTGGGGGGCTTAGG + Intergenic
993205535 5:84873526-84873548 TTCCAGCATCAGGAGCTGGTTGG + Intergenic
993458123 5:88148416-88148438 CTCCATCATCTGAATAGGGTTGG + Intergenic
995452408 5:112316546-112316568 TTTCCTCATCTGGAGGGTGAGGG - Intronic
996416013 5:123211160-123211182 TTCAATCCTCAGGAAGGGGTAGG - Intergenic
1000765761 5:165286801-165286823 TGCCAGCTGCTGGAGGGGGTGGG - Intergenic
1001884291 5:175274821-175274843 TTCCATCATCTGGTGAGGGCTGG - Intergenic
1002639840 5:180625553-180625575 TTGCATCATCTGGAGGGAGAAGG - Intronic
1002940751 6:1713467-1713489 TTCTTTCAGCTGGCGGGGGTGGG - Intronic
1004563237 6:16771195-16771217 TTCCAGCATGTGGGTGGGGTTGG + Intergenic
1004636029 6:17468693-17468715 TTCCATCAACTGGAAGAGGATGG - Intronic
1007128288 6:39446005-39446027 TTCAATCATCTGAAGGAGGGAGG - Intronic
1007215055 6:40230491-40230513 TTCCATGGTTTGGAAGGGGTAGG + Intergenic
1008032000 6:46707247-46707269 TTCCATCATTAGGCTGGGGTAGG - Intronic
1008104628 6:47428580-47428602 TTCCAGGATCTGGAGGGTGGTGG + Intergenic
1008594963 6:53032941-53032963 TTCCATCATCTGGAGGGGGTGGG - Intronic
1009530978 6:64815150-64815172 TTCTATCACTTGTAGGGGGTGGG - Intronic
1010063421 6:71651594-71651616 TCACATCATCTGAAGGGGGATGG - Intergenic
1011684557 6:89813972-89813994 TTCCAGCTACTGGAGGGGATGGG + Intronic
1018315109 6:162549041-162549063 TACCATCATCTTGGGGGGGCAGG - Intronic
1018396618 6:163382754-163382776 TTTCATCACCTTGAGGGGGAAGG - Intergenic
1018409070 6:163522927-163522949 TTCCATCATTTGTAGTTGGTAGG - Intronic
1018418220 6:163619958-163619980 TACCATCACCTGGGGGGGTTAGG - Intergenic
1018972706 6:168539677-168539699 TTCCAGCATCTGGAGCAGCTTGG + Intronic
1020108176 7:5432395-5432417 TTCCATCTGCTGGAGGGGTCCGG + Intronic
1024567797 7:50696914-50696936 TTCCATCATCTGTTGAGGGAGGG - Intronic
1027438391 7:78191935-78191957 TTCCATCATTTGTAGGGGACTGG + Intronic
1029075144 7:97928718-97928740 TTGCATGATTTGGAGGTGGTGGG + Intergenic
1036242384 8:7091660-7091682 TTCCATGATTTGGAGGGGGTGGG - Intergenic
1036258404 8:7222352-7222374 TTCCATGATTTGGAGGTGGTGGG + Intergenic
1036259464 8:7228496-7228518 TTCCATGATTTGGAGGTGGTGGG + Intergenic
1036307161 8:7611028-7611050 TTCCATGATTTGGAGGTGGTGGG - Intergenic
1036310457 8:7680948-7680970 TTCCAAGATTTGGAGGTGGTGGG + Intergenic
1036311506 8:7687066-7687088 TTCCATGATTTGGAGGTGGTGGG + Intergenic
1036358004 8:8059015-8059037 TTCCATGATTTGGAGGTGGTGGG - Intergenic
1036359077 8:8065157-8065179 TTCCATGATTTGGAGGTGGTGGG - Intergenic
1036830349 8:12015470-12015492 TTCCATGATTTGGAGGTGGTGGG + Exonic
1036891881 8:12601795-12601817 TTCCATGATTTGGAGGTGGTGGG + Intergenic
1036892945 8:12607931-12607953 TTCCATGATTTGGAGGTGGTGGG + Intergenic
1036899431 8:12659770-12659792 TTCCATGATTTGGAGGGGGTGGG + Intergenic
1036900497 8:12665917-12665939 TTCCATGATTTGGAGGTGGTGGG + Intergenic
1037016512 8:13914467-13914489 TTCCATAATCAGGAGGGAGCCGG + Intergenic
1038303075 8:26373527-26373549 TTCCATCTTTTGGGGGGGATTGG - Intergenic
1040721131 8:50324504-50324526 TTCCAGCATGTGGTCGGGGTAGG + Intronic
1041227773 8:55717224-55717246 GACCATCATCAGGTGGGGGTGGG - Intronic
1041787617 8:61652477-61652499 TTCTCTCCTCTGGAGGGGATTGG + Intronic
1042297080 8:67232179-67232201 TTCCATCACAAGTAGGGGGTGGG + Intronic
1043789711 8:84449005-84449027 TTCCATTATCTGAATGGGATTGG - Intronic
1044632227 8:94291045-94291067 TTTTATCTTCTGGAGGTGGTTGG - Intergenic
1044933361 8:97271137-97271159 TTCCATAACCTGGAGAGGGAGGG - Intergenic
1045475760 8:102550877-102550899 TTCCAGCATCTTCAGGCGGTTGG + Intergenic
1045489379 8:102656833-102656855 TCCCACCAGCTGGAGTGGGTGGG - Intergenic
1046003298 8:108447215-108447237 TTCCAGCATCTGTTGGGGGTGGG - Intronic
1046069409 8:109232424-109232446 TAAAATCATCTGGAGGGAGTAGG + Intergenic
1048960502 8:139572973-139572995 TCCCGTCATCAGGAGGAGGTAGG - Intergenic
1049983994 9:931221-931243 TTCCATTATATGGAGGGGCTTGG + Intronic
1050007133 9:1143777-1143799 TTCCATCATCTGGATGCCCTAGG - Intergenic
1051468885 9:17412018-17412040 TGACATCATGGGGAGGGGGTGGG - Intronic
1052358328 9:27528641-27528663 TTCCAACATCTGGCGGGGCTTGG - Intronic
1055345208 9:75328113-75328135 TTAGATCATCTGGAGGAGTTGGG + Intergenic
1056792005 9:89632064-89632086 CACCACCCTCTGGAGGGGGTTGG + Intergenic
1057115121 9:92513571-92513593 TTCCATCATGTGGATGGGGCAGG - Intronic
1057880882 9:98791889-98791911 CTCCATCAGCTGCAGGGGGCTGG + Intronic
1060607356 9:124927486-124927508 TTATTTCATCTGGAGGAGGTGGG - Intronic
1061758400 9:132832502-132832524 TTCCTTCATTTGGACGGGGAGGG + Intronic
1189617081 X:42794804-42794826 TCCCACCATTTGCAGGGGGTAGG - Intergenic
1190838953 X:54128173-54128195 TCCCAGCTTCTTGAGGGGGTGGG - Intronic
1190915152 X:54806161-54806183 TGCCATGATTTGGAAGGGGTGGG + Intergenic
1197010846 X:121561299-121561321 TGCCATCATGTGAAGGTGGTTGG + Intergenic