ID: 1008595721

View in Genome Browser
Species Human (GRCh38)
Location 6:53039830-53039852
Sequence CATTTGCCACCTCCACCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 222}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008595721_1008595725 -7 Left 1008595721 6:53039830-53039852 CCTCATGGTGGAGGTGGCAAATG 0: 1
1: 0
2: 2
3: 23
4: 222
Right 1008595725 6:53039846-53039868 GCAAATGGTAATGGGTTGAATGG No data
1008595721_1008595730 26 Left 1008595721 6:53039830-53039852 CCTCATGGTGGAGGTGGCAAATG 0: 1
1: 0
2: 2
3: 23
4: 222
Right 1008595730 6:53039879-53039901 TGGGAATATACAGAAGTAGGTGG 0: 1
1: 0
2: 1
3: 19
4: 235
1008595721_1008595726 -4 Left 1008595721 6:53039830-53039852 CCTCATGGTGGAGGTGGCAAATG 0: 1
1: 0
2: 2
3: 23
4: 222
Right 1008595726 6:53039849-53039871 AATGGTAATGGGTTGAATGGAGG 0: 1
1: 0
2: 5
3: 32
4: 296
1008595721_1008595728 7 Left 1008595721 6:53039830-53039852 CCTCATGGTGGAGGTGGCAAATG 0: 1
1: 0
2: 2
3: 23
4: 222
Right 1008595728 6:53039860-53039882 GTTGAATGGAGGTTAGCAGTGGG 0: 1
1: 0
2: 0
3: 20
4: 199
1008595721_1008595727 6 Left 1008595721 6:53039830-53039852 CCTCATGGTGGAGGTGGCAAATG 0: 1
1: 0
2: 2
3: 23
4: 222
Right 1008595727 6:53039859-53039881 GGTTGAATGGAGGTTAGCAGTGG 0: 1
1: 0
2: 4
3: 100
4: 939
1008595721_1008595729 23 Left 1008595721 6:53039830-53039852 CCTCATGGTGGAGGTGGCAAATG 0: 1
1: 0
2: 2
3: 23
4: 222
Right 1008595729 6:53039876-53039898 CAGTGGGAATATACAGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008595721 Original CRISPR CATTTGCCACCTCCACCATG AGG (reversed) Intronic
900431444 1:2604963-2604985 CATAGCCCACCTCCACCAGGAGG + Intronic
902147535 1:14415991-14416013 CATTTTCCATCTCCTGCATGTGG - Intergenic
902651860 1:17842615-17842637 CATTTGCCACCTGCAGCAAATGG - Intergenic
902755487 1:18546605-18546627 CATTTGCAACCTCCACCTCCCGG - Intergenic
903603240 1:24556843-24556865 CAGATGCCACCTCCTCCAAGGGG - Intronic
903871233 1:26436323-26436345 CATTTGCAACCTCCACCTTTCGG - Intronic
905227351 1:36487980-36488002 CAGTTCCCACCTCAACCAAGTGG - Intergenic
906937243 1:50225261-50225283 AATTTGGCAGCTCAACCATGTGG + Intergenic
907179793 1:52559518-52559540 CATTTTACATTTCCACCATGAGG - Intergenic
907321294 1:53604060-53604082 CATTTGTCACCTCAACGTTGTGG - Intronic
907390819 1:54157138-54157160 CAGTTGTCACCTCCTCCAAGGGG + Intronic
910011460 1:82468760-82468782 TGTTTGCCCCTTCCACCATGTGG - Intergenic
910041385 1:82855851-82855873 CATTAGCCACTTCCACCATGTGG + Intergenic
910434293 1:87189757-87189779 CAAATGCCACCTTCTCCATGAGG + Intergenic
911339666 1:96621332-96621354 TATGTGCCACCTCCATCATGTGG + Intergenic
911699932 1:100941092-100941114 AATTTGCCTCCACCACCATAGGG + Intronic
914815178 1:151057954-151057976 CACCTGCCACCACCACCATCAGG - Exonic
915722950 1:157997189-157997211 CAGCTCCCACCTCCACCATTTGG + Intronic
915941767 1:160123042-160123064 CAAATGCCACCTCCTCCATGTGG + Intronic
916757982 1:167791407-167791429 CACCTGTCACCTCCACCCTGTGG - Exonic
918019171 1:180668201-180668223 CAATTGCAACCTCCACCTTCTGG + Intronic
918470753 1:184870579-184870601 CATTTACCACCTTGACCTTGCGG - Intronic
919409228 1:197223011-197223033 CATTTGACACCTCCCTTATGAGG + Intergenic
921614346 1:217249187-217249209 CATTTGTCAGTTCCACCCTGGGG + Intergenic
921658587 1:217771064-217771086 CATTTGCCACATTCACCACTGGG + Intronic
922809737 1:228408827-228408849 CATTGGCCACATCCACCACTAGG - Intronic
923397588 1:233582345-233582367 CAGGTCCCACCTCCAACATGGGG + Intergenic
923707649 1:236357771-236357793 CAGGTCCCACCTCCAACATGGGG + Intronic
924171188 1:241342905-241342927 CATTTGACATCTCCACCAGCAGG - Intronic
1063040598 10:2333466-2333488 CACTGGCCACCTCCACCTTATGG - Intergenic
1063905207 10:10774395-10774417 CAGGTCCCACCTCCAGCATGGGG - Intergenic
1066067182 10:31771006-31771028 CAGTCCCCACCTCCACCATTGGG - Intergenic
1067314472 10:45149084-45149106 CCTTTCCCACCACCACCAAGAGG - Intergenic
1070204891 10:74248005-74248027 AATCTACCACCCCCACCATGAGG - Intronic
1070356514 10:75645521-75645543 CACTTGGCACCTCCACCACCAGG - Intronic
1070929872 10:80253435-80253457 CATCTGCCACCTCCTCCACTTGG + Intergenic
1072251183 10:93583452-93583474 CAGTTGCCACATACACTATGTGG - Intronic
1072976953 10:100067189-100067211 CATCTGCAACCTCCGCCATCTGG + Intronic
1073463319 10:103678992-103679014 CATGTGCCACGTCTTCCATGTGG - Intronic
1075310241 10:121407598-121407620 CCTGTGCCACCTCCGCCATCCGG - Intergenic
1076148655 10:128145498-128145520 CAGGTGCCACCTCCAACATGGGG - Intergenic
1076273992 10:129181260-129181282 CCTGTGCCACCTCCATTATGGGG + Intergenic
1077249637 11:1555293-1555315 CGTTTGCCCCCACCCCCATGGGG - Exonic
1077283029 11:1754122-1754144 CGCTGGCCACCTCCACCCTGCGG + Exonic
1078367572 11:10719405-10719427 CAAATACCACCTCCTCCATGGGG + Intergenic
1079788244 11:24702679-24702701 CATGCCCCACCTCCAACATGGGG + Intronic
1079794966 11:24789764-24789786 CATTTGCTTCTTCCACCATGTGG - Intronic
1079807238 11:24948401-24948423 TATTTGCAATATCCACCATGGGG + Intronic
1081933663 11:46889888-46889910 CAGAGGCCACCTCAACCATGAGG + Intronic
1083144863 11:60750539-60750561 CCTTTCGCACCTCCCCCATGGGG - Intergenic
1084527518 11:69705981-69706003 CATTTCCCTCCTGCTCCATGGGG - Intergenic
1084527961 11:69709088-69709110 CATTTCCCTCCTGCTCCATGGGG - Intergenic
1084589839 11:70084263-70084285 CTTTTGCCCCCTCAGCCATGGGG + Intronic
1084674111 11:70624286-70624308 CCATTCCCACCTCCTCCATGGGG - Intronic
1085306643 11:75490142-75490164 CAATGTCCACCTCCCCCATGGGG - Intronic
1085383907 11:76145076-76145098 CAGGTCCCACCTCCAACATGGGG - Intergenic
1085960019 11:81450654-81450676 CAGTTCCCACCTCCAGCATTGGG + Intergenic
1086569079 11:88262594-88262616 CATCTGCTGCCTCCACCTTGGGG - Intergenic
1086814621 11:91353732-91353754 CATTTTCCACCTCAACAATGGGG - Intergenic
1088687105 11:112293762-112293784 TTTCTGCCACCTTCACCATGAGG - Intergenic
1089361327 11:117888878-117888900 CATCTACCACATCTACCATGAGG - Intergenic
1093916490 12:24808100-24808122 CATTTACCACCTCCACTGGGTGG + Intergenic
1094491243 12:30962239-30962261 CCATTGGCACCTCCACCAGGTGG - Intronic
1095710509 12:45283401-45283423 GATATGCCACCTCTCCCATGAGG + Intronic
1096744079 12:53714187-53714209 CATCTGCCACCTTCTCCAGGCGG + Exonic
1096922580 12:55103451-55103473 CAGGTACCGCCTCCACCATGGGG - Intergenic
1097042398 12:56163687-56163709 CCTGTGCCACCTCCACAGTGAGG - Exonic
1099384376 12:81997244-81997266 CAGTTGCCACCACCAGCCTGAGG + Intergenic
1100154429 12:91781114-91781136 CATTGGCCATCACCAGCATGTGG - Intergenic
1104419728 12:128625358-128625380 CATTTGCCCATTCCACCACGTGG - Intronic
1106013064 13:25843527-25843549 CATTTGCCCCTTCCACTATGTGG + Intronic
1106097517 13:26661104-26661126 CATGTCCCACCTCCAACATTGGG + Intronic
1109828999 13:67761265-67761287 CAGTTCCCACCTCCAGCATCGGG + Intergenic
1109920147 13:69046072-69046094 CATTTGCCTTCTCCACCAGTGGG + Intergenic
1110085658 13:71376109-71376131 GATTTGCCTCCACCCCCATGAGG + Intergenic
1113296387 13:108963803-108963825 CACTTGCTACCACCACCCTGTGG + Intronic
1113789769 13:113022144-113022166 CAGATGCCACCTCCACACTGTGG + Intronic
1114491059 14:23102263-23102285 CATCTGCCACCTCCTCCAGGAGG - Intergenic
1115318231 14:32049572-32049594 CATTAGTCACCTCCACCAGAAGG + Intergenic
1116739699 14:48738731-48738753 CTGTTGCCAACTCCACCATAAGG + Intergenic
1117574650 14:57085900-57085922 CATCTGCCACCTCCCCCTGGAGG - Intergenic
1120396181 14:83970120-83970142 CAGGTGCCTCCTCCAGCATGTGG + Intergenic
1121731854 14:96192908-96192930 CATTTGCCACCCTCATCAGGTGG - Intergenic
1121943587 14:98096849-98096871 ATTTTCCCACCTGCACCATGTGG + Intergenic
1122174942 14:99909863-99909885 CATCTGCCACCACCTCCCTGAGG + Intronic
1122987070 14:105217403-105217425 CATTTGCCACCTGCATGCTGGGG - Intronic
1123875411 15:24618848-24618870 CATTTCCCATCTCCATCATTGGG + Intergenic
1125246531 15:37647325-37647347 CCTTGGGCACCTCCACCCTGTGG - Intergenic
1125471653 15:40010364-40010386 CATTTACCACCTCCTTCCTGTGG + Intronic
1125585398 15:40815900-40815922 CATTAGCTACCTCCCCCATTGGG + Intronic
1128402981 15:67303691-67303713 CCCTTGCCACCACCACTATGTGG + Intronic
1128785532 15:70394172-70394194 CATCTCCCACCACCACCATCAGG - Intergenic
1128863053 15:71090913-71090935 CAGGTCCCACCTCCAACATGGGG + Intergenic
1130149061 15:81297493-81297515 CAGTGGTCACCTCCTCCATGAGG + Intronic
1133918512 16:10130982-10131004 CATTTGCCTCCTGAACCTTGAGG - Intronic
1136076086 16:27818150-27818172 CATTTGCCACCAGGACCATGGGG - Intronic
1136099456 16:27982890-27982912 CAGTCCCCACCTCCAACATGGGG + Intronic
1139243528 16:65418752-65418774 CATTTGCCCCTTCCACTTTGTGG - Intergenic
1141651398 16:85394956-85394978 CAATTGCCACTTCCTCCAGGGGG - Intergenic
1142173147 16:88633331-88633353 CATTTGTGAGCTGCACCATGAGG + Intergenic
1142724129 17:1799442-1799464 CATTTGCAACCTCCACCTCCCGG + Intronic
1143436980 17:6936456-6936478 CATGAGCCACCCCCACCCTGTGG - Intronic
1143541065 17:7569414-7569436 CATTTCCCACATCCAACCTGCGG - Intronic
1144933171 17:18876743-18876765 CAAATGTCACCTCCACAATGAGG - Intronic
1148875384 17:50684005-50684027 CCTTTGCCGCCTCCAGGATGCGG - Exonic
1149913918 17:60590668-60590690 CATTTGCCACCTTCTCTATGGGG - Intergenic
1152087236 17:78227738-78227760 CATCTGCCACCTCCACTACAGGG - Intergenic
1156469637 18:37369164-37369186 TATCTGCAGCCTCCACCATGGGG + Intronic
1156473176 18:37390146-37390168 CATATGCCACCTACAGCATGTGG - Intronic
1157445728 18:47745563-47745585 CACCAGCCACCTCCACCTTGGGG + Intergenic
1158253127 18:55512458-55512480 CATTGGCTATCTCCACAATGAGG + Intronic
1162191862 19:8953358-8953380 TGTGTACCACCTCCACCATGGGG - Exonic
1162368674 19:10265601-10265623 CCTCTGCCACCTCCACCTTCCGG + Intergenic
1162518574 19:11165519-11165541 CATTTGCCAAGGCCTCCATGTGG + Intronic
1164681046 19:30133966-30133988 CATTTGCCATTTCCTCCATGGGG - Intergenic
1165364842 19:35359100-35359122 CATTGGCTGCCTCCACCATGCGG - Exonic
1165366661 19:35371569-35371591 CATTGGCTGCCTCCACCATGCGG - Exonic
1166250022 19:41563579-41563601 AATTTTCCACCTCCACCACTAGG - Intronic
925140788 2:1548832-1548854 CATTTTCTACCTCCCCCATCGGG + Intergenic
925467917 2:4126196-4126218 CATTTGCCAGCTTCTCTATGTGG + Intergenic
926149262 2:10415626-10415648 CATGTGGCTCCTTCACCATGCGG - Intronic
928066879 2:28174401-28174423 CACTTGCCTCCTCCACAAAGAGG + Intronic
932000183 2:67877816-67877838 CAAGTGCCACCTCCAGAATGGGG - Intergenic
934780163 2:96964893-96964915 CCTTTGCCATCTCCTCCTTGTGG + Intronic
934936413 2:98469131-98469153 CATTTGCCACCTTTCCCATGAGG + Intronic
935044052 2:99463442-99463464 CGTTTGCAACCTCCACCTTCTGG - Intronic
935493684 2:103752205-103752227 GATTTTCCTCCTCCACCAAGAGG + Intergenic
937647119 2:124277859-124277881 CATTAGCAATCACCACCATGCGG + Intronic
938100536 2:128495082-128495104 CCTTTGCCTCCTTCACCATCTGG - Intergenic
938137621 2:128772078-128772100 TATTTGCCACCTGCACCATTAGG + Intergenic
941521426 2:166549437-166549459 CATTTAACACCTCCATCATTTGG - Intergenic
941701309 2:168606734-168606756 CAGGTCCCACCTCCAGCATGGGG - Intronic
942125694 2:172822950-172822972 CATTTTGCACCTCCACCTGGTGG - Intronic
942221279 2:173771312-173771334 CATTTGCCACATCCAGCAGAGGG - Intergenic
944669659 2:201984443-201984465 GACTTGCCATCTCTACCATGTGG + Intergenic
947950024 2:234139072-234139094 GCTATGCCACCTTCACCATGTGG - Intergenic
948076441 2:235168524-235168546 TGTCTGCCACCTCCTCCATGAGG - Intergenic
948661850 2:239512168-239512190 CCTTTGCCCCTTCCACCACGTGG + Intergenic
1169353692 20:4890575-4890597 CACTTGCAACCTCCACCTTCCGG - Intronic
1170059533 20:12244816-12244838 CATTTCCCACCTGGACCATGAGG + Intergenic
1171139867 20:22731252-22731274 CATCTTCCTCTTCCACCATGAGG - Intergenic
1172128148 20:32637494-32637516 CAGATGTCACCTCCTCCATGAGG + Intergenic
1173943452 20:46931852-46931874 CATTTGCCTTCTCCACCAATAGG + Intronic
1174158981 20:48536928-48536950 CTTCTGCCACCTCCAGCATCTGG - Intergenic
1175212364 20:57368710-57368732 CAGTTGCCACCACAGCCATGGGG - Exonic
1175218715 20:57404955-57404977 CTCGTGGCACCTCCACCATGGGG - Intronic
1177338440 21:19763787-19763809 CCCTTGCCCCTTCCACCATGTGG + Intergenic
1177551158 21:22624318-22624340 TATTTGCCACTTCTACCATAAGG + Intergenic
1178181736 21:30169499-30169521 CATGTGCCACCTCCACCTCCAGG + Intergenic
1179098361 21:38335479-38335501 CATTTGCCGCCTCCAGCTTCTGG + Intergenic
1179647843 21:42786117-42786139 CATGTCCCACCTGCACCATAGGG + Intergenic
1179982801 21:44905364-44905386 CATTTGCCCCCTGCACAGTGGGG + Intronic
1180671297 22:17555652-17555674 CATTTGCCATCTTCTCCATTAGG + Intronic
1182541633 22:31046210-31046232 CAAATGCCACCTCCTCCAAGGGG - Intergenic
1183664255 22:39238285-39238307 CTTCTGCCTCCTCCACCAGGAGG + Intronic
1184598970 22:45531644-45531666 CATGAGCCACTTCCACCCTGAGG + Intronic
1184769147 22:46587800-46587822 CATCTGCCACCTCCACTGTTAGG - Intronic
951624242 3:24642699-24642721 CATTTTCCAGCTCCAAGATGTGG + Intergenic
952307242 3:32157163-32157185 CAGATGCCGCCTCCTCCATGTGG + Intronic
953411676 3:42693728-42693750 CATTTGCCATCACCACACTGTGG - Exonic
954710882 3:52504560-52504582 CAGTGGCCAGCTCCACCATGGGG - Intronic
959995834 3:112679374-112679396 CATTTGCCCCTTCCACCTTGTGG - Intergenic
960314187 3:116156149-116156171 CATTTGCCACCCCCTGCCTGGGG - Intronic
962478883 3:135781308-135781330 CCTTTGCCACCTCCAACTTCTGG - Intergenic
965732822 3:171790739-171790761 AATCTGCCACCTCCAGGATGTGG - Intronic
966297785 3:178444158-178444180 TATTTGCCCCTTCCACCTTGTGG + Intronic
966641025 3:182190619-182190641 CATTTGCCCCTTCCACCATGTGG + Intergenic
967261480 3:187647171-187647193 CATTTCCCACTTCAACCATATGG + Intergenic
967468290 3:189833103-189833125 ACTTTGCCTCCACCACCATGAGG + Intronic
968921558 4:3524689-3524711 CAGTGGCCACCTCCCTCATGAGG + Intronic
969148777 4:5149639-5149661 CATTTGACACCTACACTATAAGG - Intronic
969445148 4:7240528-7240550 CAGTTCCCACCTCCACCACGAGG - Intronic
970669237 4:18377122-18377144 CAATTGCAACCTTCACCAGGTGG + Intergenic
972407650 4:38762168-38762190 CATTTCCCACCTCTCCCAGGCGG + Intergenic
974610259 4:64207554-64207576 CTTTTGATACCACCACCATGGGG - Intergenic
976777293 4:88720512-88720534 CATTTGCCACCCGCTCCACGGGG - Intergenic
977475281 4:97499700-97499722 CATTTGCCACCTTCTCCCAGAGG - Intronic
982446562 4:155497503-155497525 TGTTTGCCCCTTCCACCATGTGG - Intergenic
982514914 4:156333706-156333728 TGTTTGCCACTTCCACCATGTGG - Intergenic
985837782 5:2283210-2283232 CACTGGCCACCTTAACCATGTGG + Intergenic
989317131 5:40094591-40094613 TATTAGCCACATCCACCCTGTGG - Intergenic
990102806 5:52213908-52213930 CATCTTCCACCTCCACATTGTGG - Intergenic
990596502 5:57317428-57317450 CATTTGGCAAATCCACCATTTGG - Intergenic
993160871 5:84289391-84289413 TATTTCCCAGCTCCTCCATGAGG + Intronic
996226551 5:121006583-121006605 CAGTTGCCACCTCCAATATTTGG + Intergenic
999897854 5:156053893-156053915 CCCTTGCCCCTTCCACCATGTGG - Intronic
1000457061 5:161462944-161462966 CATTTGACAACTCCACCTTTGGG + Intronic
1002429734 5:179196067-179196089 CCTTCCCCACCGCCACCATGCGG + Intronic
1002496243 5:179613710-179613732 CACCTGCAACCTCCACCTTGTGG - Intergenic
1006849957 6:37091295-37091317 CACCAGCCGCCTCCACCATGTGG + Intergenic
1007707960 6:43802804-43802826 CATATGTCACCTCCTCCAAGAGG + Intergenic
1008595721 6:53039830-53039852 CATTTGCCACCTCCACCATGAGG - Intronic
1009755849 6:67939312-67939334 CCTTTCACACCTCCACCATTGGG + Intergenic
1009968658 6:70604024-70604046 CCTTTCCCACCTCCACCGTTAGG - Intergenic
1011274374 6:85615294-85615316 CATATGCCCCCTCCAACAAGAGG - Exonic
1012311830 6:97735106-97735128 GATTTGTCACCTCCTGCATGAGG - Intergenic
1015974887 6:138779844-138779866 CCTTTGCCCTCTCCACCCTGAGG - Exonic
1017392619 6:153958010-153958032 CACCTCCCACCTCCAACATGGGG + Intergenic
1018789040 6:167131913-167131935 CATGTGCCACCCCCACAATCAGG + Intronic
1019970701 7:4538489-4538511 CAGTTAGCACCTTCACCATGTGG + Intergenic
1021564474 7:22003511-22003533 CATTTGCCATCTCTAAAATGGGG - Intergenic
1021964474 7:25904175-25904197 CATTTCCTTCCTCAACCATGTGG - Intergenic
1022130355 7:27399477-27399499 CATCTCCCACCTCCAAAATGGGG + Intergenic
1022798049 7:33748637-33748659 CATCTGGCAGCTCCACTATGAGG - Intergenic
1024150872 7:46569930-46569952 CGTTTGCCACCTCCATCTTTAGG + Intergenic
1024249881 7:47498035-47498057 CACTCCCCACCTCCACCCTGCGG - Intronic
1024261351 7:47576365-47576387 CATTTGTCACCTGCAGCCTGGGG - Intronic
1024315453 7:48011977-48011999 AATTTACCACATCCACAATGTGG + Intronic
1027232288 7:76279835-76279857 CATTTGCCACCTCTATCCAGCGG + Intronic
1028831051 7:95326992-95327014 CCTGTCCCACCTCCACCATTGGG - Intergenic
1028863916 7:95685969-95685991 CATGTTCCACCTCCACCCCGTGG - Intergenic
1028903278 7:96124903-96124925 CATTTGCATCCTCCAGCAAGGGG + Intronic
1028930643 7:96409171-96409193 CTTCTGCCAGCTCCTCCATGTGG - Intergenic
1032740208 7:134730937-134730959 CTATTGCCACCTCCAGCATCTGG + Intergenic
1032750590 7:134836218-134836240 GCTTTGCCTCCTCAACCATGAGG + Intronic
1032882329 7:136102982-136103004 GGCTTGCCACCTTCACCATGGGG - Intergenic
1034267267 7:149787269-149787291 CAGGTGCCACCCCCACCAGGGGG - Intergenic
1034789329 7:153953862-153953884 GACTTGCCAGCACCACCATGAGG - Intronic
1035455924 7:159008567-159008589 CTTTTCCCAACTCCACCAAGAGG + Intergenic
1035838764 8:2787924-2787946 AATGTGCCAGCTTCACCATGGGG - Intergenic
1036708864 8:11065377-11065399 CCTTGGCCAGCTCCACCATTCGG + Intronic
1037147617 8:15592391-15592413 CAGGTGCCACCTCCAACATTGGG - Intronic
1040287613 8:46108468-46108490 CATCTGCTCACTCCACCATGCGG + Intergenic
1040598586 8:48863124-48863146 CATTCTCCACATGCACCATGTGG - Intergenic
1040731798 8:50456653-50456675 CACTTGCTACCACCACAATGGGG + Intronic
1041030414 8:53730814-53730836 CCTTTTCCACCTCAACCAGGAGG + Intronic
1041529853 8:58853118-58853140 CATTTACTGCCTCCACCATGAGG + Intronic
1043589259 8:81808632-81808654 TATTGGCCTCCACCACCATGGGG - Intronic
1044335843 8:90984732-90984754 GATTTGCCCCCTCCACCCGGTGG - Intronic
1048068699 8:130999494-130999516 CCTTTCCCACCTCCACTCTGGGG - Intronic
1048787117 8:138062381-138062403 GATCTGCCACCTCCTCCATGAGG - Intergenic
1052958925 9:34277901-34277923 CACATGCCAGCTCTACCATGTGG + Intronic
1058770099 9:108222677-108222699 CATATCCCACCTCCAACATTAGG - Intergenic
1059612814 9:115917303-115917325 CATGTCCCACCTCCAACATTGGG + Intergenic
1062298927 9:135853087-135853109 CACATGCCACCTGCACCAAGGGG + Intronic
1186449574 X:9660952-9660974 CCTTTGCCCCTTCTACCATGTGG + Intronic
1187716469 X:22107256-22107278 CATCTTCCACCACCACCATTGGG + Intronic
1189393638 X:40600826-40600848 CATTTGACACCTCCCTCATTAGG + Exonic
1191870399 X:65740534-65740556 CATTTCCCCCATCCACCCTGGGG - Exonic
1192184278 X:68936186-68936208 CATTTGCAACCTCTCCCATTAGG - Intergenic
1194069924 X:89310108-89310130 CCTTTGCCACTTCTGCCATGTGG + Intergenic
1195768460 X:108321874-108321896 ACTGTTCCACCTCCACCATGAGG + Intronic
1196989030 X:121307377-121307399 GTTTTGCCACCTCAACAATGTGG + Intergenic
1197200363 X:123743338-123743360 TTTTTGCCAGCACCACCATGTGG - Intergenic
1197472784 X:126883395-126883417 CAGGTGCCACCTCCAACATTGGG - Intergenic
1199726704 X:150590230-150590252 CATGTGCCAGTTCCACAATGAGG - Intronic
1200268845 X:154662413-154662435 CATTTGGCTCCTCCAGCATCAGG - Intergenic
1200724073 Y:6644244-6644266 CCTTTGCCACTTCTGCCATGTGG + Intergenic