ID: 1008595729

View in Genome Browser
Species Human (GRCh38)
Location 6:53039876-53039898
Sequence CAGTGGGAATATACAGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008595721_1008595729 23 Left 1008595721 6:53039830-53039852 CCTCATGGTGGAGGTGGCAAATG 0: 1
1: 0
2: 2
3: 23
4: 222
Right 1008595729 6:53039876-53039898 CAGTGGGAATATACAGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008595729 Original CRISPR CAGTGGGAATATACAGAAGT AGG Intronic
No off target data available for this crispr