ID: 1008595729 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:53039876-53039898 |
| Sequence | CAGTGGGAATATACAGAAGT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1008595721_1008595729 | 23 | Left | 1008595721 | 6:53039830-53039852 | CCTCATGGTGGAGGTGGCAAATG | 0: 1 1: 0 2: 2 3: 23 4: 222 |
||
| Right | 1008595729 | 6:53039876-53039898 | CAGTGGGAATATACAGAAGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1008595729 | Original CRISPR | CAGTGGGAATATACAGAAGT AGG | Intronic | ||
| No off target data available for this crispr | |||||