ID: 1008598367

View in Genome Browser
Species Human (GRCh38)
Location 6:53065403-53065425
Sequence CATGCTCGGCGCGTCGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008598359_1008598367 11 Left 1008598359 6:53065369-53065391 CCGGGCCGCCCACACGGGCAGCA 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1008598367 6:53065403-53065425 CATGCTCGGCGCGTCGGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 56
1008598361_1008598367 6 Left 1008598361 6:53065374-53065396 CCGCCCACACGGGCAGCACCGGC 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1008598367 6:53065403-53065425 CATGCTCGGCGCGTCGGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 56
1008598356_1008598367 27 Left 1008598356 6:53065353-53065375 CCGCGGGGATGGGTGGCCGGGCC 0: 1
1: 0
2: 2
3: 15
4: 282
Right 1008598367 6:53065403-53065425 CATGCTCGGCGCGTCGGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 56
1008598362_1008598367 3 Left 1008598362 6:53065377-53065399 CCCACACGGGCAGCACCGGCACT 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1008598367 6:53065403-53065425 CATGCTCGGCGCGTCGGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 56
1008598363_1008598367 2 Left 1008598363 6:53065378-53065400 CCACACGGGCAGCACCGGCACTG 0: 1
1: 0
2: 1
3: 15
4: 134
Right 1008598367 6:53065403-53065425 CATGCTCGGCGCGTCGGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 56
1008598355_1008598367 28 Left 1008598355 6:53065352-53065374 CCCGCGGGGATGGGTGGCCGGGC 0: 1
1: 0
2: 1
3: 25
4: 852
Right 1008598367 6:53065403-53065425 CATGCTCGGCGCGTCGGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008598367 Original CRISPR CATGCTCGGCGCGTCGGCGC AGG Intronic
905862538 1:41361196-41361218 CCTGCTCGGCGCGGAGGCGGGGG - Intergenic
924644161 1:245861625-245861647 CATGTTCTGCGCGTCTGCACAGG + Intronic
924957677 1:248944959-248944981 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
924957682 1:248944988-248945010 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1068845168 10:61663244-61663266 CGTGCACGGCGCGCCGGGGCCGG - Intronic
1076306140 10:129467008-129467030 CATGCCCTGTGCGGCGGCGCCGG - Intergenic
1081699945 11:45146699-45146721 CAGCCTCGGCGCGGCGGCGGCGG - Intronic
1084171121 11:67401538-67401560 GCTGCTCCGCGCGTCGGAGCTGG + Intronic
1103479245 12:121240654-121240676 CATGCGCGCCGCGTCGCCTCTGG - Exonic
1113989951 13:114353294-114353316 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1113989956 13:114353323-114353345 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1113989961 13:114353352-114353374 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1113989966 13:114353381-114353403 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1122775922 14:104116947-104116969 CCTGCTCCGCGCGCCCGCGCGGG - Intergenic
1122861150 14:104582898-104582920 CATGCTCGGCAGGTGGGGGCGGG - Intronic
1124652368 15:31483459-31483481 CGCGGTCGGCGCGTCGGCGTCGG + Exonic
1132947175 16:2538093-2538115 CATGGGCCCCGCGTCGGCGCGGG - Exonic
1135421623 16:22309010-22309032 CGTGCTGGTCTCGTCGGCGCAGG - Exonic
1144339745 17:14301679-14301701 CAGCCCCGGCGCGGCGGCGCAGG - Exonic
1144656955 17:17042829-17042851 CATGGTCGGCGCGGCGGCGACGG - Exonic
1147200644 17:38799422-38799444 CATGCCCGGGGCGGCGGCGGCGG + Exonic
1148911246 17:50944319-50944341 CAGGCTTGGCGCGGAGGCGCAGG + Intergenic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1160653410 19:246517-246539 AAGGCACGGCGCGCCGGCGCCGG + Intergenic
1160653416 19:246546-246568 CAGGCGCGGCGCGCCCGCGCAGG + Intergenic
1160971004 19:1767743-1767765 GATGCTGGGGGCGGCGGCGCAGG + Intronic
1164179734 19:22807760-22807782 CAGGCTCCGTGCGGCGGCGCTGG - Intergenic
949000443 2:241610148-241610170 CATGCCCGGCGCCGCGGCCCTGG - Intronic
1179488558 21:41726357-41726379 AATGCTCGGCGCGGGGGCGCGGG + Intergenic
1180264139 21:46698846-46698868 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264144 21:46698875-46698897 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264149 21:46698904-46698926 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264154 21:46698933-46698955 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264164 21:46698991-46699013 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264169 21:46699020-46699042 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264174 21:46699049-46699071 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264179 21:46699078-46699100 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264184 21:46699107-46699129 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264189 21:46699136-46699158 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264194 21:46699165-46699187 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264199 21:46699194-46699216 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264204 21:46699223-46699245 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264209 21:46699252-46699274 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1183149730 22:36028360-36028382 CATGCCCCGGGCGGCGGCGCCGG + Exonic
1185430377 22:50807227-50807249 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
953627239 3:44581024-44581046 CATGGTCGGCGCGGCGGCGGCGG + Intronic
985466744 4:190203771-190203793 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
985466749 4:190203800-190203822 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
999748804 5:154611025-154611047 CTTGCTGGGCGCGTGGGCGTGGG - Intergenic
1002635915 5:180608752-180608774 CATGCTGGCCACGTGGGCGCTGG - Intronic
1006189517 6:32199026-32199048 CATGCTCTCGGCGTCGACGCCGG + Exonic
1008598367 6:53065403-53065425 CATGCTCGGCGCGTCGGCGCAGG + Intronic
1024262414 7:47582202-47582224 CAGGCTCGGGGCGCGGGCGCGGG - Intronic
1035429537 7:158808315-158808337 CATGCTCGGCGCGAACGTGCCGG - Intronic
1035512933 8:206251-206273 AAGGCACGGCGCGCCGGCGCTGG + Intergenic
1035512938 8:206280-206302 GAGGCGCGGCGCGCCGGCGCAGG + Intergenic
1060825066 9:126683156-126683178 CCTCCTCGCCGCGTCGGGGCCGG - Intronic
1062230725 9:135480101-135480123 CCTGCACGGCGCGCCGGCCCCGG - Intronic
1062428777 9:136517737-136517759 CATGCCCGGTGCGTCGGCCGGGG - Exonic
1195071801 X:101288422-101288444 CATGCTGGGCGCGGTGGCTCAGG - Intronic