ID: 1008599910

View in Genome Browser
Species Human (GRCh38)
Location 6:53082244-53082266
Sequence CTGGCAAAATAATCTTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008599907_1008599910 1 Left 1008599907 6:53082220-53082242 CCTAAAACATTTATTTTAATATG 0: 1
1: 0
2: 7
3: 156
4: 1222
Right 1008599910 6:53082244-53082266 CTGGCAAAATAATCTTATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008599910 Original CRISPR CTGGCAAAATAATCTTATGA GGG Intronic
No off target data available for this crispr