ID: 1008602070

View in Genome Browser
Species Human (GRCh38)
Location 6:53106245-53106267
Sequence GCATCTACTAGGTTTGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008602070_1008602075 17 Left 1008602070 6:53106245-53106267 CCCAATTCAAACCTAGTAGATGC No data
Right 1008602075 6:53106285-53106307 AGTGAGAACTACCAACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008602070 Original CRISPR GCATCTACTAGGTTTGAATT GGG (reversed) Intergenic
No off target data available for this crispr