ID: 1008602119

View in Genome Browser
Species Human (GRCh38)
Location 6:53106596-53106618
Sequence GGCGTGGCCTCCTGAGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008602113_1008602119 3 Left 1008602113 6:53106570-53106592 CCCTGTCGCCCAGGCTGGAATGC 0: 77
1: 2074
2: 7178
3: 6831
4: 7876
Right 1008602119 6:53106596-53106618 GGCGTGGCCTCCTGAGTTGAAGG No data
1008602116_1008602119 -5 Left 1008602116 6:53106578-53106600 CCCAGGCTGGAATGCAGTGGCGT 0: 922
1: 27384
2: 142895
3: 248910
4: 202422
Right 1008602119 6:53106596-53106618 GGCGTGGCCTCCTGAGTTGAAGG No data
1008602117_1008602119 -6 Left 1008602117 6:53106579-53106601 CCAGGCTGGAATGCAGTGGCGTG 0: 984
1: 27558
2: 119866
3: 196449
4: 218767
Right 1008602119 6:53106596-53106618 GGCGTGGCCTCCTGAGTTGAAGG No data
1008602114_1008602119 2 Left 1008602114 6:53106571-53106593 CCTGTCGCCCAGGCTGGAATGCA 0: 96
1: 2099
2: 8017
3: 7686
4: 4973
Right 1008602119 6:53106596-53106618 GGCGTGGCCTCCTGAGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008602119 Original CRISPR GGCGTGGCCTCCTGAGTTGA AGG Intergenic
No off target data available for this crispr