ID: 1008602863

View in Genome Browser
Species Human (GRCh38)
Location 6:53112666-53112688
Sequence ATGTGGTAGAAAGTAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008602863_1008602867 3 Left 1008602863 6:53112666-53112688 CCTGTGTTTACTTTCTACCACAT No data
Right 1008602867 6:53112692-53112714 GGCCAGTGCCACACCTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008602863 Original CRISPR ATGTGGTAGAAAGTAAACAC AGG (reversed) Intergenic
No off target data available for this crispr