ID: 1008605665

View in Genome Browser
Species Human (GRCh38)
Location 6:53137107-53137129
Sequence CTGTGGTTTGGGAAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1114
Summary {0: 1, 1: 0, 2: 2, 3: 89, 4: 1022}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008605655_1008605665 28 Left 1008605655 6:53137056-53137078 CCTTCTCAGGGCATGACAGTGGC 0: 1
1: 0
2: 1
3: 11
4: 198
Right 1008605665 6:53137107-53137129 CTGTGGTTTGGGAAGGGGGAAGG 0: 1
1: 0
2: 2
3: 89
4: 1022
1008605656_1008605665 2 Left 1008605656 6:53137082-53137104 CCCTTTGTGTGCTATGCTGTAAC 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1008605665 6:53137107-53137129 CTGTGGTTTGGGAAGGGGGAAGG 0: 1
1: 0
2: 2
3: 89
4: 1022
1008605657_1008605665 1 Left 1008605657 6:53137083-53137105 CCTTTGTGTGCTATGCTGTAACT 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1008605665 6:53137107-53137129 CTGTGGTTTGGGAAGGGGGAAGG 0: 1
1: 0
2: 2
3: 89
4: 1022

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008605665 Original CRISPR CTGTGGTTTGGGAAGGGGGA AGG Intronic
901689787 1:10965256-10965278 CTGTGGTCTGGAGTGGGGGAAGG - Intronic
901757697 1:11451272-11451294 CTGGGGCTGGGGAAGCGGGAGGG + Intergenic
901842165 1:11960623-11960645 CTGGGGTTGGGGATGGGGAAGGG - Intronic
902237682 1:15068256-15068278 CTGGGTTCTGGGAGGGGGGATGG + Intronic
903213668 1:21831748-21831770 CAGTGGTGTGGGATGGCGGATGG + Exonic
903261974 1:22136398-22136420 CTGGGGTTGGGGAAAGAGGAGGG + Intronic
903271513 1:22191401-22191423 ATGTGGTTTGGAAAGGGAGAAGG + Intergenic
903387615 1:22938221-22938243 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
903557859 1:24206398-24206420 CTGGGGCTGGGGAAGGGAGAGGG - Intergenic
903591558 1:24459953-24459975 CTGTGGTATGGGAGTGGGGTGGG - Intronic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
905238308 1:36565621-36565643 TTATGGGTTGGGGAGGGGGAAGG - Intergenic
905274383 1:36807544-36807566 CTGGGGCATGGGCAGGGGGATGG + Intronic
905322854 1:37130171-37130193 CTGGGGTGGGGGAAGGGGGATGG - Intergenic
905347339 1:37319866-37319888 CTGGGGATTGGGAATGAGGAAGG + Intergenic
905414498 1:37794776-37794798 CTGGGGTGTGGGAAGGAGGAAGG - Intronic
905474937 1:38219403-38219425 GGGTGGTTTAGGAAGAGGGAAGG + Intergenic
906197856 1:43940150-43940172 CTGGGGATAGGGAAAGGGGATGG - Intergenic
906305993 1:44719552-44719574 CAGTGGTCTGGGAAGGCAGAGGG - Intronic
906882633 1:49608916-49608938 CTGTGGTGGGGGAGGGGTGATGG - Intronic
906911679 1:49958693-49958715 GTGGGGTTGGGGAGGGGGGAGGG + Intronic
907310662 1:53537184-53537206 CTCTGGCTTGGGGAGGGGGAGGG + Intronic
908114504 1:60927651-60927673 AGGTGGTCTGGGATGGGGGAAGG + Intronic
909048929 1:70745413-70745435 CTGGGGTTGGGGGAGGTGGAGGG + Intergenic
909067508 1:70953283-70953305 CTGGGATTTTGGTAGGGGGAAGG + Intronic
909180710 1:72420335-72420357 CTGTGGTGGGGGGAGGGAGAGGG - Intergenic
909317367 1:74240923-74240945 GTGGGGTGTGGGGAGGGGGAGGG - Intronic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
909663608 1:78110036-78110058 GTGGGGTGGGGGAAGGGGGAGGG + Intronic
909672066 1:78200471-78200493 CTTTGGTTTAGGAAGGGGATGGG - Intergenic
910513128 1:88028042-88028064 CTGTGGTCTGGGAATGTGGTTGG + Intergenic
910601382 1:89036246-89036268 GTGGGGTTGGGGGAGGGGGAGGG - Intergenic
910643483 1:89489388-89489410 CTGGGGCTTGGAATGGGGGAAGG - Intergenic
910894370 1:92052428-92052450 CTTTGGCTTTGGAAAGGGGATGG - Intronic
911057378 1:93720535-93720557 CTGTGGTCTGGGAAGGCGAGTGG - Intronic
911450539 1:98054824-98054846 CTGTGAATTGGGGAGAGGGAGGG + Intergenic
911748563 1:101468612-101468634 CTGAGGAATGGGAAGGGGAAGGG + Intergenic
911855235 1:102868420-102868442 ATGAGATTTGGGAAGGGGAAAGG - Intergenic
912065193 1:105730017-105730039 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
912530292 1:110315880-110315902 CTGGGGTGTGGGGTGGGGGAGGG + Intergenic
912584800 1:110752778-110752800 CTGGGGTGGGGGAAGGGGGGAGG - Intergenic
912672589 1:111644774-111644796 CTTTTTTTGGGGAAGGGGGAGGG + Intronic
912694644 1:111832074-111832096 CTGTGGTGTGGGTAATGGGATGG - Intronic
913301993 1:117381327-117381349 GTGGGGTTGGGGGAGGGGGAAGG - Intronic
913396946 1:118381853-118381875 CTGTGGTTTGGTGAGAGGGAGGG - Intergenic
914807666 1:151003382-151003404 CTGTGGTTTGGGATTGTGTAAGG - Intronic
914918826 1:151834116-151834138 CTGTGGTTTAGGGTTGGGGAAGG - Intergenic
915045989 1:153017708-153017730 GTGTGGTTGGGGGAGGGGGGAGG - Intergenic
915168051 1:153959486-153959508 CTGTGCTTTGAGAAAGAGGAAGG + Exonic
915752895 1:158228468-158228490 CTGTGCTTGAGGAAAGGGGAGGG + Intergenic
915841735 1:159218633-159218655 CTGGGGTTTGGGAGGGGGCTCGG - Intergenic
915910926 1:159914851-159914873 CTGTGGTCGGGGAAGGGGTGTGG + Intergenic
917485480 1:175451362-175451384 GTGGGGTGGGGGAAGGGGGAAGG - Intronic
917570046 1:176256228-176256250 GTGGGGTTGGGGGAGGGGGAAGG - Intergenic
917650433 1:177071361-177071383 TTGTGGTCAGGGAAGAGGGAAGG + Intronic
918246337 1:182662936-182662958 CTGTAGATTGAGAATGGGGAGGG + Intronic
918358056 1:183724575-183724597 CTCTGCTTGTGGAAGGGGGAGGG + Intronic
918364395 1:183791084-183791106 GTTTAGTTTGGGGAGGGGGAAGG - Intronic
918666170 1:187154223-187154245 CTGTGCCTTTGGAAAGGGGAGGG - Intergenic
918820157 1:189243441-189243463 CTGGGGTGGGGGGAGGGGGAGGG - Intergenic
919133338 1:193477908-193477930 CTTTAGTTTGGGATGGGGGTTGG + Intergenic
919255199 1:195111645-195111667 GTGGGGTGTGGGAGGGGGGAGGG + Intergenic
919433759 1:197531585-197531607 GTGGGGTTGGGGGAGGGGGAAGG - Intronic
919854775 1:201697766-201697788 GTGTGGTTTGGGGATGGGAATGG - Intronic
919983832 1:202659181-202659203 CTGTGCATTGGGAAAGGGGAGGG - Intronic
920035008 1:203059991-203060013 GTGTGTGTTGGGGAGGGGGAGGG - Intronic
920070091 1:203296531-203296553 GTGTGGTCAGGGAAGGGTGAAGG - Intergenic
920160855 1:203996719-203996741 CTGTAGGTTGGGAGGGGGTAGGG + Intergenic
920365839 1:205448011-205448033 CAGTAATTTGGCAAGGGGGAAGG + Intronic
920369519 1:205469298-205469320 CTGTGGGCTGGGGAAGGGGAAGG - Intergenic
920434819 1:205940924-205940946 CTGTGTTCTGGGAAGAGGAAAGG + Intronic
920570906 1:207016559-207016581 GTGTGGATTGGGAAGGAGGCAGG + Intronic
920578055 1:207077532-207077554 GTGCCCTTTGGGAAGGGGGATGG + Exonic
921670114 1:217915938-217915960 CAGTGTTTTGGTAAGGGGAATGG - Intergenic
922383298 1:225055677-225055699 GTGTGGTGGGGGAGGGGGGAGGG - Intronic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
922854333 1:228761152-228761174 TTGTGGGTAGGGCAGGGGGAGGG + Intergenic
922912347 1:229228366-229228388 CGGGGGGGTGGGAAGGGGGAGGG - Intergenic
923202857 1:231728984-231729006 TTGGGGTTGGGGGAGGGGGAGGG - Intronic
923259876 1:232258359-232258381 CTGTGGTGAGGGGAGGGAGAAGG + Intergenic
923455885 1:234164829-234164851 CTGTGATTTGGGTGGGGGGGGGG + Intronic
923712141 1:236395910-236395932 CTGCGGCATGGGCAGGGGGAAGG - Intronic
923729693 1:236538468-236538490 CTGTGCTTTGGGTAGCTGGATGG + Intronic
1062769621 10:88452-88474 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1063221738 10:3975229-3975251 CTGTGGGCTGGGAAGAGGGGCGG + Intergenic
1063396723 10:5694805-5694827 CTGGGGTCTGGGATGGGGGTAGG - Intronic
1063608350 10:7542214-7542236 CTCTGTTTTGGGAAGTAGGACGG - Intergenic
1064104316 10:12488513-12488535 CCGTGGACTGGGATGGGGGATGG + Intronic
1064274962 10:13897429-13897451 CTGAGGTTTGGAAATGGGGGAGG + Intronic
1064614109 10:17134941-17134963 CAGAGGTTGGGGGAGGGGGAGGG + Intergenic
1065957082 10:30703499-30703521 CTGTAGGGTGGGAAGGGGGTTGG - Intergenic
1066021586 10:31309218-31309240 CTGTTGTGTGGGGTGGGGGAGGG - Intergenic
1066271383 10:33827540-33827562 CTGTTGGTGGGGCAGGGGGATGG + Intergenic
1066421886 10:35271455-35271477 CTGTGCTTCTGGCAGGGGGAAGG + Intronic
1066469211 10:35681794-35681816 CTGTGGTTTGTGAAGAGACATGG - Intergenic
1066594173 10:37030601-37030623 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
1067077390 10:43196017-43196039 CCCTGCTTTGGGGAGGGGGAGGG - Exonic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067300967 10:45009315-45009337 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1067404581 10:46010061-46010083 CTGTAGTGCGGGCAGGGGGATGG + Intronic
1067985186 10:51135959-51135981 CTGTTGTGGGGGAAGGGGGGAGG + Intronic
1068043978 10:51862317-51862339 CTGTTGTTTGGCAAGTGGGAGGG + Intronic
1068262026 10:54595043-54595065 GTATGGTTTGGGAAGGTGGAGGG - Intronic
1068390836 10:56394882-56394904 CTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1068568863 10:58606412-58606434 CTGGGGTGGGGGAGGGGGGAGGG + Intronic
1068689943 10:59905484-59905506 CTTTGGGTTGGGAGGGTGGACGG - Intronic
1068861716 10:61854657-61854679 TGGAGGTTTGGGAAGGGGAAGGG - Intergenic
1069002755 10:63284028-63284050 TTGTTTTTTGGGAGGGGGGACGG + Intronic
1069184075 10:65400471-65400493 GAGTGGTGGGGGAAGGGGGAAGG - Intergenic
1069618414 10:69820934-69820956 CTCTGGTTTGGGGGTGGGGAGGG - Intronic
1069753375 10:70759183-70759205 CTTTGCTTTGGGAAGGAAGACGG - Intronic
1069991993 10:72321748-72321770 CTGTGATAGGGAAAGGGGGAGGG - Intergenic
1070030671 10:72674173-72674195 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1070786461 10:79165061-79165083 TTGTGGGTTGGGTAGGGGGGTGG + Intronic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1071060137 10:81560533-81560555 GTGGGGTTTGGGGAGGGGGGAGG - Intergenic
1071299758 10:84247751-84247773 CTGTGGACTGGGGAGGGGGCTGG - Intronic
1071459893 10:85882621-85882643 GTGGGGTTGGGGGAGGGGGAAGG + Intronic
1071961706 10:90813758-90813780 ATGTGGTTTGGCAAGGAGAAGGG - Intronic
1072253474 10:93600195-93600217 CTGAGGTTTGGGGAGGGGGTAGG + Intronic
1072397370 10:95058785-95058807 GTGTGGTGGGGGGAGGGGGAAGG - Intronic
1072606702 10:96990166-96990188 CTGGGGGCTGGGCAGGGGGAGGG - Intergenic
1072751797 10:97986078-97986100 CTGGGCTCTGGGAAGGAGGAAGG + Intronic
1072752011 10:97987880-97987902 GTGTGGTTGGGAAAGGGGGTAGG - Intronic
1073002292 10:100294702-100294724 CTGTGATTAGGAAAGTGGGATGG - Intronic
1073178920 10:101572356-101572378 CTCTGGTTTGGGAGGAGGAAGGG + Intronic
1073271128 10:102265029-102265051 CTGTGGCATGGGATGGGGCATGG + Intronic
1073423080 10:103440066-103440088 CTGTTGTTGGGGATGGTGGAGGG + Intronic
1073529288 10:104216640-104216662 CTGTGGGTGGGGAAGGGGAGAGG - Intronic
1073588857 10:104736922-104736944 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1074100795 10:110353715-110353737 GTGAGGTTGGGGGAGGGGGAGGG - Intergenic
1074353409 10:112759757-112759779 TTGTGGGGTGGGAAGGGGGCTGG - Intronic
1074476915 10:113781771-113781793 GAGTTGTTGGGGAAGGGGGAAGG - Intronic
1074501934 10:114033571-114033593 CTTTGGTTTGAGAATGTGGAGGG - Intergenic
1074763923 10:116686817-116686839 TTATGGTTTGGGAAGGGGTGGGG - Intronic
1074781912 10:116808290-116808312 CTCTGGTGGGGAAAGGGGGACGG + Intergenic
1074950486 10:118329567-118329589 GTGGGGTTTGGGGAGGGTGATGG - Intronic
1075379990 10:122011234-122011256 GTGTGGCTGGGGAAGTGGGAAGG + Intronic
1075381642 10:122023644-122023666 GTGGGGTTGGGGGAGGGGGAGGG + Intronic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1075840623 10:125499366-125499388 GTGTGATTTGGGGATGGGGAGGG - Intergenic
1075926190 10:126253684-126253706 TTGTGGGTTGGGTGGGGGGAGGG + Intronic
1076088893 10:127661653-127661675 GTGGGGTTGGGGAAGGGGGAGGG - Intergenic
1076212950 10:128664949-128664971 CTGGGGGATGGGAATGGGGAAGG + Intergenic
1076450256 10:130552190-130552212 CTGTGGGCTGGGGAGGTGGAGGG + Intergenic
1078309520 11:10226471-10226493 GTGGGGTTGGGGAGGGGGGAGGG - Intronic
1078574074 11:12483860-12483882 CTGAGGTTTGGAAAGGGCTAGGG - Intronic
1079170356 11:18088315-18088337 CTGAGGTTTGGGAATATGGATGG + Intronic
1079174491 11:18126633-18126655 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1079181717 11:18199849-18199871 CAGGGATTTGGGAAGGGGGATGG - Intronic
1079460817 11:20676347-20676369 CTGTGGGTTAGGTTGGGGGAGGG - Intronic
1079516736 11:21277898-21277920 GTGGGGTGAGGGAAGGGGGAGGG + Intronic
1079579840 11:22050271-22050293 CTGTGGTTGGGAGTGGGGGAGGG - Intergenic
1079742024 11:24073954-24073976 GTGGGGTTGGGGGAGGGGGAGGG + Intergenic
1080323138 11:31038068-31038090 CTGTTGTTGGGGGAGGGGGGAGG + Intronic
1080481982 11:32661089-32661111 CTCTGGTTGGAGAAAGGGGAAGG + Intronic
1080594480 11:33758230-33758252 GTCTGGTATGGGATGGGGGATGG - Intronic
1080809560 11:35689796-35689818 CTGAGGACTGGGCAGGGGGAAGG - Intronic
1080963376 11:37186232-37186254 CTGTGGTTAGGGAATGGGACCGG - Intergenic
1081636725 11:44726877-44726899 CGGAGGTTTGGGGAGGGGGAGGG + Intronic
1082292250 11:50389865-50389887 GTGGGGTGTGGGAAGGGGGAGGG + Intergenic
1082317629 11:50749160-50749182 CTGGGGTTGGGGGAGGGGGTAGG + Intergenic
1082581623 11:54876835-54876857 CTATGGTTGTGGAGGGGGGAGGG + Intergenic
1082702834 11:56454381-56454403 CTGTAGTTTGGCAAGCAGGAGGG - Intergenic
1082787835 11:57326660-57326682 CTGTGGGCTGGGCAGGGTGAGGG - Intronic
1082811048 11:57479184-57479206 CTGGGGCCTGGGCAGGGGGAGGG + Intergenic
1082882702 11:58053864-58053886 CTGGTGGTTGGGATGGGGGATGG - Intronic
1083163012 11:60867323-60867345 CTGTGGCTTTGGAAGGGAGGAGG - Intergenic
1083304679 11:61756182-61756204 CTGTGGGATGGGTAAGGGGAGGG + Intronic
1083701618 11:64482943-64482965 CTTTGGTTTTGGGTGGGGGATGG + Intergenic
1083766835 11:64845269-64845291 CTGAGGCTTGGGAAGGAGGAAGG + Intergenic
1083802985 11:65057537-65057559 GTGTGGGTGGGGAAGGGGGGTGG + Intronic
1084178886 11:67437010-67437032 CTGAGGCCTGGGATGGGGGATGG + Intronic
1084406825 11:68979109-68979131 CTGTGGGAAGGAAAGGGGGAGGG + Intergenic
1085133596 11:74064041-74064063 TTGTGGGGTGGGACGGGGGAGGG - Intronic
1086396832 11:86423887-86423909 CTTTGGTTTAGAAAGGGGAAGGG - Intergenic
1086478033 11:87200775-87200797 CAGGGGTTTGGGCAGAGGGAAGG - Intronic
1087893939 11:103566475-103566497 CTTTCTTTTGGGTAGGGGGAGGG + Intergenic
1087953719 11:104257571-104257593 CCGGGGTTTGGGGAGGGGTAAGG + Intergenic
1088490507 11:110382924-110382946 GTGGGGTTTGGGGAGGGGGGAGG - Intergenic
1088710634 11:112505442-112505464 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1088718915 11:112574791-112574813 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1088795294 11:113262277-113262299 CTGTGCTTAGGGATTGGGGATGG - Intronic
1088877610 11:113948883-113948905 AAGTGCTTTGGGAAGGGGGAGGG + Intergenic
1088948464 11:114539282-114539304 GTGTGGTCTGGGGAGGGGGGAGG + Intronic
1089303483 11:117512602-117512624 CTGAGGGTGGGGAAGGGGGAAGG + Intronic
1089317248 11:117600534-117600556 CTGTGGTGTGGGCGGAGGGATGG - Intronic
1089419382 11:118319723-118319745 CTTTGATTTGGCAAGGAGGAGGG - Intergenic
1089536272 11:119162324-119162346 CAGTGGCTGGGGAAGGGGTAGGG - Exonic
1089690792 11:120185574-120185596 CTGTGGTGTGGGGTGGGGAAGGG - Intergenic
1090075799 11:123579315-123579337 CCGTGCTTTGGGGAGGAGGAGGG + Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090245282 11:125211798-125211820 CTGAGCTTTGGGAATGGGGGAGG + Intronic
1090940799 11:131386519-131386541 CTGTGGTGTAGGAAGGAGGCAGG + Intronic
1090977466 11:131689714-131689736 CTGCGGTATGGGAGGGGAGATGG - Intronic
1091055709 11:132416967-132416989 CTCTGTTTTGGGAAGGGGAAGGG + Exonic
1091329522 11:134720295-134720317 TTGTGGTTGGGGGAGGGGGGAGG - Intergenic
1091668931 12:2438624-2438646 ATGTGGCTGGGGAACGGGGAGGG + Intronic
1091797305 12:3304602-3304624 CTCTGGTGTGGGAATGGGGCTGG + Intergenic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1091944470 12:4523808-4523830 GTGGGGTTGGGGGAGGGGGAAGG + Intronic
1092468785 12:8760086-8760108 GTGGGGTAGGGGAAGGGGGAGGG - Intronic
1092700750 12:11228245-11228267 TTGTTGTTTTGGAAGGGGCAAGG + Intergenic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1092907833 12:13118097-13118119 CTCTGGTTTGCCAAGGGAGAGGG - Intronic
1093037013 12:14341712-14341734 CTGTAGTTTTAGAAAGGGGAAGG - Intergenic
1093176502 12:15918516-15918538 CAATCGTTTGGGAAGGGGAAGGG + Intronic
1093195935 12:16129673-16129695 CTGAGGCTTGGGCAGTGGGAAGG + Intergenic
1093302822 12:17476291-17476313 CTGGGGTGTGGGGAGGGGGGAGG + Intergenic
1093742175 12:22701105-22701127 CCTTGGTTTAGGAAGGGGGCGGG + Intergenic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1094640960 12:32275334-32275356 CAGTGGTTTGGGAGTGAGGATGG + Intronic
1095183615 12:39175660-39175682 CTGGAGTTGGGGCAGGGGGATGG - Intergenic
1095185105 12:39192415-39192437 GTGGGGTTGGGGAAGGGGGGAGG - Intergenic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095943009 12:47738615-47738637 CTGTGGCCTGGGAAGGGGCAGGG - Intronic
1095990245 12:48029599-48029621 CAGGGGTCTGGGATGGGGGAGGG - Intergenic
1096199077 12:49668446-49668468 ATGGGGTTTGGGAAAGAGGAGGG - Intronic
1096546182 12:52341643-52341665 CTGTGGCTTAGGAAGGGGAAAGG + Intergenic
1096610385 12:52797127-52797149 CTGGGGTTTGTGAGGGGGCATGG - Intergenic
1097053829 12:56238691-56238713 CAGGGGTTTGGGAAGGGTTAGGG - Exonic
1097106741 12:56630247-56630269 CCGGGGTTCGGGAAGGGGGAGGG + Intronic
1097568445 12:61299754-61299776 GTGGGGTGTGGGGAGGGGGAGGG + Intergenic
1098130466 12:67344978-67345000 CTGTGGTGAGGGGAGGGGGAGGG - Intergenic
1098209494 12:68148771-68148793 CTGTGGCTCTGGCAGGGGGAGGG - Intergenic
1098253765 12:68595513-68595535 CTGTGTTTTGGGGAGGGGCAGGG - Intergenic
1098474073 12:70879101-70879123 GTGGGGTGTGGGGAGGGGGAAGG + Intronic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1099196854 12:79626731-79626753 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1099239563 12:80123175-80123197 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1099842495 12:87983532-87983554 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1100109287 12:91218563-91218585 TTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1100318738 12:93469641-93469663 ATGTGGGTTGGGGAGGGGAATGG + Intronic
1100545449 12:95597808-95597830 ATGGGGTTGGGGGAGGGGGAGGG - Intergenic
1101036320 12:100710678-100710700 CTGTTGGTGGGGGAGGGGGAGGG + Intergenic
1101280608 12:103251233-103251255 GTGGGGTTGGGAAAGGGGGATGG - Intronic
1101804115 12:108048413-108048435 CTGAGGTTTGTGGAGGGGGAGGG + Intergenic
1102056701 12:109901775-109901797 CTTTGGTTTAGGAAGGGGAGGGG - Intronic
1102352474 12:112204290-112204312 CTGAGTTCTGGGAAGTGGGAAGG + Intronic
1102986415 12:117281917-117281939 CTTTGGTTTGGTAAGGAGGGTGG - Intronic
1103277746 12:119727437-119727459 CTGTGGATTCAGAAGGGGGAAGG + Intronic
1103602216 12:122061573-122061595 CTGTGGTGGGGGGAGGGCGAGGG - Exonic
1103867497 12:124064492-124064514 CTGTGTTTTGGGAAAGGGGAGGG + Intronic
1104476270 12:129073009-129073031 CTGTGGGTGGGGGAGGGAGAGGG - Exonic
1104484673 12:129140412-129140434 CTGTGGTCAGGGATTGGGGAGGG - Intronic
1104545995 12:129713464-129713486 GTGTGTTTTGGGAAGGAGGAGGG + Intronic
1104630450 12:130397120-130397142 CTCTGATTTGGGAGGTGGGAGGG - Exonic
1104880525 12:132067695-132067717 CTGAGGTCTTGGCAGGGGGATGG + Intronic
1105257482 13:18753700-18753722 CTTTGGTTTAGAAAGGGGAAGGG - Intergenic
1105508065 13:21028071-21028093 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1106502180 13:30339668-30339690 AAGAGGTTTGGGCAGGGGGAGGG - Intergenic
1107435780 13:40379726-40379748 GTGTGGTTTGGGAAAGAGAAGGG - Intergenic
1107798369 13:44078902-44078924 ATATTGTTTGGGTAGGGGGAGGG + Intergenic
1108171041 13:47742185-47742207 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1108464039 13:50696409-50696431 CTGTAGTTTGGCAAGCAGGAGGG + Intronic
1108839528 13:54594626-54594648 CAGTGGGTTGGGGAAGGGGAGGG + Intergenic
1109005049 13:56863383-56863405 ATGTGCTTAGGAAAGGGGGATGG - Intergenic
1109058908 13:57587167-57587189 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1109365802 13:61354992-61355014 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1109932325 13:69232264-69232286 CTATGGTTTGAGAAGGGGCTTGG + Intergenic
1110173894 13:72534170-72534192 CTTTGGTTTGGGGAAGCGGAGGG + Intergenic
1110236990 13:73227433-73227455 GTGTGCATTGGGAAGGGTGAAGG - Intergenic
1110365876 13:74685229-74685251 CAGAGGTTTGGAAAGGGGGTAGG + Intergenic
1110479886 13:75961647-75961669 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1110659859 13:78047777-78047799 CTGGGGTTGGGGGAGGGGGGAGG - Intergenic
1111013190 13:82339646-82339668 CCATGGATTGGGAAGGGGGGTGG - Intergenic
1111367739 13:87271397-87271419 CTGGGGTTGGGGGAGGGGGGAGG + Intergenic
1111593143 13:90375656-90375678 GTGGGGTTGGGGGAGGGGGAGGG + Intergenic
1111640069 13:90957385-90957407 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1111723535 13:91976120-91976142 ATGGGGTTGGGGGAGGGGGAAGG + Intronic
1111915463 13:94355928-94355950 CTGTTGTGGGGGCAGGGGGAGGG - Intronic
1112119453 13:96393730-96393752 CTGTGGCAAGGGAAGGGAGATGG + Intronic
1112167155 13:96931760-96931782 AGGGGGTTTGGGAAGAGGGATGG + Intergenic
1112482181 13:99786348-99786370 GTGGGGTTGGGGGAGGGGGAAGG - Intronic
1112488002 13:99836889-99836911 GTGGGGTGGGGGAAGGGGGAGGG + Intronic
1112901437 13:104362787-104362809 CTCTGCTTTTGGAAAGGGGAGGG - Intergenic
1112907254 13:104439171-104439193 CTGTTGTGGGGGAAGGGGGGAGG + Intergenic
1113278421 13:108761248-108761270 CTGTATTTTGGGAAGGGTCAAGG - Intronic
1113694764 13:112336684-112336706 CTGTGGTGGGGGCAGAGGGAGGG + Intergenic
1114412913 14:22517599-22517621 CTGTCTTTTGGGAAGGGGCTCGG - Intergenic
1114576342 14:23717690-23717712 ATGGGGTTGGGGAAGGGGGGAGG - Intergenic
1114777333 14:25498659-25498681 CTGGGGTGGGGGAGGGGGGATGG + Intergenic
1114803647 14:25807782-25807804 GTGGGGTTTGGGGAGGGGGAGGG + Intergenic
1115067837 14:29286240-29286262 GTGGGGTTGGGGGAGGGGGAGGG + Intergenic
1115381565 14:32745906-32745928 CCCTGGTTTTGGAAAGGGGATGG - Intronic
1115412748 14:33093968-33093990 GTGGGGTGGGGGAAGGGGGAGGG + Intronic
1115477737 14:33832165-33832187 ATGGGGTTGGGGGAGGGGGAAGG + Intergenic
1115549189 14:34489774-34489796 CTGTGTTTTGGTTAGGTGGAGGG + Intergenic
1115752510 14:36506113-36506135 CTCGGGTTAGGGAAGCGGGATGG + Intronic
1116057931 14:39886291-39886313 CTCTGCCTTGGGAAAGGGGAGGG + Intergenic
1116062530 14:39941937-39941959 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1116724376 14:48544081-48544103 ATGGGGTGTGGGGAGGGGGATGG - Intergenic
1117065273 14:52007615-52007637 CTGGGGTTTGGGTGGAGGGAAGG - Exonic
1118181045 14:63493500-63493522 GTGTGGTGGGGGGAGGGGGAGGG + Intronic
1118259326 14:64232976-64232998 CTGAGAGTTGGGAAGGTGGAGGG + Intronic
1118592233 14:67410392-67410414 CTGCGGCTTGGGAGGTGGGAGGG - Intronic
1119092933 14:71801416-71801438 CTGTGGGATGGGATGGGGGATGG - Intergenic
1119180832 14:72604322-72604344 CAGTGATTTGGGATTGGGGATGG - Intergenic
1119432231 14:74575916-74575938 CTGTGGGTTTGGAAGAGGGAGGG - Intronic
1120581517 14:86256168-86256190 CTTTGGTTTAGGAATGGGGGGGG - Intergenic
1120586934 14:86323087-86323109 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1120750737 14:88195692-88195714 CTGGGGTTTTGGAAGTAGGATGG - Intronic
1120961031 14:90125189-90125211 CTGGGGGTTGGGGATGGGGAAGG - Intronic
1121092800 14:91194498-91194520 CTGAGGTTAGGGAGGGGGGATGG + Intronic
1121301252 14:92873021-92873043 CAGAGGTTTGGGCAGGAGGAAGG + Intergenic
1121559195 14:94862007-94862029 CTGTGGGTTGGTAAGAGGGAGGG + Intergenic
1121687895 14:95852767-95852789 CTGTGTTTTGGGCAGGAGGATGG + Intergenic
1121708934 14:96022448-96022470 CTGAGCTTTGAGAAGGGGCATGG - Intergenic
1121794737 14:96725514-96725536 CTGTGGGCTGGGAAGGTGGGAGG - Intergenic
1122092612 14:99350174-99350196 CTGTAAATTGGGAAGGGCGATGG + Intergenic
1122152402 14:99732095-99732117 CTGTCATTTGGGAGGGGGCAGGG - Intergenic
1122211836 14:100178559-100178581 CTGTGGCTGGGGAAGGGGAGTGG + Intergenic
1122637325 14:103136173-103136195 CTGAGGTCTGGGCAGGGGCAGGG + Exonic
1122882201 14:104695206-104695228 CTGTGGTTAGGGACTGGGAAGGG - Intronic
1123499752 15:20868921-20868943 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123593225 15:21879884-21879906 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1124042541 15:26118550-26118572 GGGTGATGTGGGAAGGGGGATGG + Intergenic
1124054978 15:26233959-26233981 TGCTGGTTTGGGAAGGTGGAAGG - Intergenic
1124094227 15:26633824-26633846 CTTTGGTTTAGAAAGGGGAAGGG - Intronic
1125272348 15:37952973-37952995 CTCTGCTTTTGGAAAGGGGAGGG + Intronic
1125440435 15:39696920-39696942 GTGTGTGTTGGGATGGGGGAAGG + Intronic
1127713453 15:61624372-61624394 CTCTGGTTTGTGGAAGGGGAGGG - Intergenic
1128257562 15:66209744-66209766 CTGGGGTTTAGGAAGGGGTAAGG + Intronic
1128999257 15:72319461-72319483 CTGTGATCTGGGAAGGGGGCTGG + Intronic
1129281663 15:74489916-74489938 CTGTCATTTGGGGAGGGTGAGGG + Intergenic
1129294914 15:74594870-74594892 CTGTGGTTTGGGAGGGTTGGGGG + Intronic
1129324054 15:74790282-74790304 CAGAGTTTTGGCAAGGGGGAAGG + Intronic
1130014296 15:80175166-80175188 CTGAGCTTTGGCAAGGGTGAGGG + Intronic
1130118320 15:81024735-81024757 CTGTGGTGGAGGCAGGGGGAAGG + Intronic
1131064450 15:89424862-89424884 CTGGGTTTGGGGCAGGGGGAAGG + Intergenic
1131082773 15:89550796-89550818 CTGTTGGTAGGGATGGGGGAAGG + Intergenic
1131285516 15:91053781-91053803 CTGGGGTTAGGGAGGGGTGAAGG - Intergenic
1131684803 15:94757299-94757321 CTTTGGATTGGGAAGAAGGACGG - Intergenic
1131802701 15:96088027-96088049 ATGAGGTTAGAGAAGGGGGAAGG - Intergenic
1132091692 15:98952567-98952589 CTGTGGTTTAGGGTGGGTGAGGG + Intronic
1202965344 15_KI270727v1_random:169808-169830 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1132458753 16:38998-39020 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132715758 16:1289120-1289142 CTGGGGTCTGGGAATGGAGAGGG + Intergenic
1132982151 16:2743637-2743659 TTCTGGTTTGGGAGCGGGGAAGG + Intergenic
1133268373 16:4598434-4598456 CTGGGGTTTGGGGCGGGGAAAGG + Intronic
1133431957 16:5745084-5745106 ATGAGGTGGGGGAAGGGGGAGGG - Intergenic
1134105036 16:11479113-11479135 CTGTACTTTGGGAGGGGGAAGGG + Intronic
1134291290 16:12904109-12904131 CTGTGGTTGCGGAAGGTGGGCGG - Intronic
1134447712 16:14343467-14343489 CTGGGGTTGGGGGAGGGGGTAGG - Intergenic
1135830846 16:25771505-25771527 GTGTGGTTTGCCAAGGGGAAAGG - Intronic
1135843087 16:25894209-25894231 CTGTGTTCTGTGAAGGGGGCAGG + Intronic
1136186477 16:28591508-28591530 CTGTGGTCTAGGCTGGGGGAAGG + Intronic
1136188964 16:28604232-28604254 CTGTGGTCTAGGCTGGGGGAAGG + Intergenic
1137298863 16:47126460-47126482 CAGTGGTTTGGGGAAAGGGAGGG + Intronic
1137502725 16:49023934-49023956 CTTTCATTTGGGAAGGAGGAAGG + Intergenic
1137568812 16:49551374-49551396 GTGTATTTTGGGAGGGGGGATGG - Intronic
1138257182 16:55576132-55576154 CCTTGGTTTGGGGAAGGGGAAGG + Intronic
1138261135 16:55623526-55623548 GTGTGGAATGGGAATGGGGAAGG - Intergenic
1138496459 16:57412011-57412033 CTGTGGCTTGAGGAGGGGGCAGG + Intronic
1138830910 16:60373740-60373762 CTGTGGTTGGGGCAGCGAGAGGG - Intergenic
1139002596 16:62531229-62531251 ATGTGGGGTGGGAAGGGTGACGG + Intergenic
1139434445 16:66927937-66927959 CTGTGGTGTGAGGAGGGGGTGGG - Intergenic
1139482426 16:67237822-67237844 CTGTTGCTGGGGAAGGGGAAGGG + Intronic
1139599109 16:67976042-67976064 CAGTGGTTTGAGAAGGGGAGGGG - Intronic
1139800421 16:69518284-69518306 GTGGGGTTGGGGGAGGGGGAAGG + Intergenic
1140225201 16:73071361-73071383 CTGTGGTCTGGCAGTGGGGAAGG - Intergenic
1140508312 16:75488587-75488609 CTGGGCATTTGGAAGGGGGAAGG + Intronic
1141396273 16:83707947-83707969 CTGTGAGTTGGCAAGGGGAATGG + Intronic
1141456513 16:84145621-84145643 ATGTGGTGTGGGAAGGGGGCTGG - Intronic
1141585376 16:85030006-85030028 CTGTGGAATGGGAAGTGGGGCGG + Intronic
1142067582 16:88071609-88071631 CTCTGCCTTGGGAATGGGGAGGG + Intronic
1142179191 16:88659031-88659053 CTTTTGTTTGGGAAGGTGGAGGG - Intronic
1142228358 16:88888317-88888339 CTGTGGCCTGGGCTGGGGGAGGG - Intronic
1142418130 16:89954167-89954189 GTGTGGTTGGGGAAAGGGGGTGG + Intronic
1142739196 17:1920804-1920826 CTTTGGTTTGGGGAGGGAGAAGG - Intergenic
1142755623 17:2014932-2014954 CTGTGGTGGGGCCAGGGGGAAGG + Intronic
1142803855 17:2361538-2361560 CTGTGGTGAGGCAAGGGGTAAGG - Intronic
1142866109 17:2792556-2792578 CTGAGGGCTGGAAAGGGGGAAGG - Intronic
1143105798 17:4530100-4530122 CTTTGGTGTGTGCAGGGGGAGGG + Intronic
1143118725 17:4594674-4594696 CTGTGATTGGGGATGGGGGTAGG + Intronic
1143197380 17:5086382-5086404 ATGTGGTAAGGGAAGGGGAAAGG - Intronic
1143203730 17:5129337-5129359 CTGTGGGTGGGGAGGAGGGAAGG + Intronic
1143250259 17:5518250-5518272 CTGGGATTTAGGAAAGGGGATGG - Intronic
1143477637 17:7211752-7211774 CGGGGGTTGGGGGAGGGGGAGGG + Intronic
1143544406 17:7588018-7588040 CTGGGGTGGGGGAAGGGGGACGG + Exonic
1143832001 17:9659999-9660021 CTTTGGGATGGGAATGGGGATGG + Intronic
1144457372 17:15430218-15430240 CTGTGCTTTGGGAAGCTGCAGGG + Intergenic
1144583400 17:16473345-16473367 CAGTGGTTTTGTTAGGGGGAGGG - Intronic
1144649614 17:16999037-16999059 CAGGGGCTGGGGAAGGGGGAAGG - Intergenic
1144729106 17:17516646-17516668 GTGTGCTTTGGGGATGGGGAGGG + Intronic
1144836773 17:18160654-18160676 CTGTGGTTTGGAGATGGGCATGG - Intronic
1144874910 17:18392448-18392470 CTGTGGGTGGGGAGGAGGGAAGG + Intergenic
1145157315 17:20551973-20551995 CTGTGGGTGGGGAGGAGGGAAGG - Intergenic
1145254944 17:21317276-21317298 CTGAGGTGGGGGAATGGGGATGG + Intergenic
1145321658 17:21770689-21770711 CTGAGGTGGGGGAATGGGGATGG - Intergenic
1145993306 17:29091943-29091965 CAGTGGGCTGGGCAGGGGGAAGG + Intronic
1146095982 17:29930409-29930431 CTGTGGAGTGGGGTGGGGGAAGG + Intronic
1146908597 17:36633483-36633505 ATGGTGTTTGGGCAGGGGGATGG + Intergenic
1147161116 17:38569859-38569881 CTGTGGCCTGGGGAAGGGGAGGG + Intronic
1147167571 17:38601591-38601613 CTGTGGTGTGGGGAGGGGGATGG + Intronic
1147188954 17:38728014-38728036 CTTTGGTTTGGGCTGAGGGAGGG - Exonic
1147189495 17:38730427-38730449 CTGGGGTTCGGGACGGGGGCTGG - Intronic
1147192982 17:38748123-38748145 CTGGGGATTGGGATGGGGGCCGG - Intronic
1147306371 17:39567042-39567064 CTCTGCTTTGGGAGGGGGAAGGG + Intergenic
1147390321 17:40105257-40105279 GTGTGGTGGGGGGAGGGGGATGG + Intergenic
1147462032 17:40578943-40578965 GTGGGGTTGGGGGAGGGGGAGGG + Intergenic
1147715795 17:42507445-42507467 CTGTGAGGTGGGAAGGGCGATGG - Intronic
1147957773 17:44146580-44146602 ATCTGCTTTAGGAAGGGGGAAGG - Intronic
1147966337 17:44196230-44196252 GTGTGGGTGGGGAAGGGGGGTGG - Intronic
1148218573 17:45847287-45847309 CTCTGGATTGGGAAGGGGTTGGG - Intergenic
1148323342 17:46770401-46770423 CTGGACTTTGGGAAGGTGGAGGG - Intronic
1148330168 17:46809459-46809481 GTGTGTGTTGGGGAGGGGGATGG - Intronic
1148905709 17:50910531-50910553 CTGTGGTCTGGGTGGGGGCAGGG + Intergenic
1148914097 17:50960134-50960156 CAGTGCTTTGGGAAGGGAGGTGG - Intergenic
1149387849 17:56159648-56159670 GTGTGTCTTGGAAAGGGGGAGGG - Intronic
1149428346 17:56576995-56577017 CTTTGGTTTGGGACCTGGGAGGG - Intergenic
1149443472 17:56694980-56695002 CAGGGGTTAGGGGAGGGGGAAGG - Intergenic
1149774861 17:59349324-59349346 CTGTGGGCTGAGAAAGGGGAGGG - Intronic
1149958322 17:61078404-61078426 CTGTGGTTTGGCCTGAGGGATGG - Exonic
1150007670 17:61479683-61479705 CTGGGGTTGGGGAGGAGGGAAGG + Intronic
1150072527 17:62163960-62163982 CTGTGGTAGGTGAAGGGGCAAGG - Intergenic
1150230830 17:63549653-63549675 CTGTGAGTTGGAAAAGGGGAAGG - Intergenic
1150280240 17:63925866-63925888 CTGTGTTCTGGGGAGGGGGCAGG + Intergenic
1151101871 17:71565177-71565199 CTGTGGTTTGTGAATTGGGTAGG - Intergenic
1151156479 17:72127169-72127191 CTGGGGTGTGGGAGTGGGGATGG - Intergenic
1151595876 17:75077810-75077832 CTGCGTTTTGGGAGGTGGGATGG - Intergenic
1152814590 17:82399904-82399926 CTCTGGGGAGGGAAGGGGGATGG + Intronic
1152962686 18:89242-89264 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1153841028 18:9008008-9008030 ATGGGGTGGGGGAAGGGGGAAGG + Intergenic
1154341514 18:13506361-13506383 CTGGGGTGGGGGGAGGGGGAGGG - Intronic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1155110699 18:22711279-22711301 CTGTGACTTGGGAAAGGGAAGGG - Intergenic
1155178458 18:23322225-23322247 TTGTGGTTTAGGGAGGAGGATGG + Intronic
1155293634 18:24365654-24365676 CTGGGGCATGGGAAAGGGGAAGG + Intronic
1155364572 18:25036825-25036847 CTGTGGTGTGGGGAGGTGGCAGG + Intergenic
1155710735 18:28875519-28875541 GTGTGGGTCAGGAAGGGGGAAGG - Intergenic
1155756841 18:29509145-29509167 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1156004366 18:32422131-32422153 GTGGGGTTGGGGAAGGGGGGAGG - Intronic
1156308686 18:35903475-35903497 GTGGGGTTGGGGGAGGGGGAGGG + Intergenic
1156897737 18:42265808-42265830 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic
1157011129 18:43650232-43650254 CTGTGTTTTGGGAGAGAGGAAGG + Intergenic
1157274479 18:46301264-46301286 CTGTAGCTTGGCCAGGGGGAGGG + Intergenic
1157525526 18:48377393-48377415 CTCTGCTTGGGGAAGGGGGTGGG + Intronic
1158312206 18:56170971-56170993 CTGGGGTTGGGGAGGGGGAAAGG + Intergenic
1158531757 18:58268967-58268989 CTGAGGCTTGGGAAGGGAGGAGG - Intronic
1158920434 18:62186563-62186585 CTGTGGGTGGGGACGGGGGCTGG - Intronic
1159134138 18:64317194-64317216 CTGTTGTCAGGGGAGGGGGAGGG - Intergenic
1159406582 18:68010470-68010492 CAGTGGTTCGGGAAGGGAGACGG - Intergenic
1159453442 18:68631593-68631615 ATGTGATTTGGGAGGGGTGAGGG + Intergenic
1160226519 18:77016285-77016307 CTGTGGTCTGAGAAGTGGAAGGG - Exonic
1160461642 18:79043411-79043433 GTGGGGGTTGGGATGGGGGATGG - Intergenic
1160461667 18:79043459-79043481 GTGAGGGTTGGGATGGGGGATGG - Intergenic
1160594820 18:79965765-79965787 GTGTGGTGTGAGGAGGGGGATGG + Intronic
1160753567 19:746831-746853 CTGTGGTGTGGGGTGGGGGCCGG - Exonic
1160830848 19:1104342-1104364 CTGGGGTCGGGGAAGGGGAAGGG + Intronic
1160923565 19:1532091-1532113 CAGTAGTGTGGGTAGGGGGAAGG + Intronic
1160944538 19:1635251-1635273 CTGTTCTTTGGGAGGAGGGAAGG - Intronic
1161141207 19:2649054-2649076 TTATGTTCTGGGAAGGGGGAAGG + Intronic
1161202897 19:3025668-3025690 GTGTGGGTGGGGAAGGGGGCGGG + Intronic
1161448262 19:4329811-4329833 CTGGGGGTGGGGGAGGGGGAGGG - Intronic
1161712206 19:5855246-5855268 CTTTGGTTTGGGAAGAAGGGCGG - Intergenic
1162034026 19:7929636-7929658 CTCTGGCCTGGGAAGTGGGATGG + Intronic
1162158589 19:8696298-8696320 ATGTGTTTTGGGAAGATGGATGG + Intergenic
1162237375 19:9319803-9319825 GTGTGGTGGGGGGAGGGGGAGGG + Intergenic
1163039086 19:14589129-14589151 GCCAGGTTTGGGAAGGGGGAAGG - Intronic
1163179140 19:15586457-15586479 CTGTGGTGGGGGCAGGAGGAGGG - Intergenic
1163191797 19:15682316-15682338 CTGATGTTTGGGACTGGGGAGGG + Intronic
1163201416 19:15772208-15772230 CTGATGTTTGGGACTGGGGAGGG - Intergenic
1163438694 19:17310549-17310571 CTGAGGGCTGGGAAGGGTGATGG + Intronic
1163588247 19:18175582-18175604 CTGGGGTTTGGAGAGGGGGCAGG - Intronic
1163628678 19:18405244-18405266 AGGTGGCTGGGGAAGGGGGAGGG - Intergenic
1163927827 19:20362420-20362442 CTTTGGTTTAGGAAGGGGAGGGG - Intergenic
1163929115 19:20371836-20371858 CTTTGGTTTAGGAAGGGGAGGGG - Intergenic
1165070802 19:33253850-33253872 CTGTGGGGTGGGTAGGGGGCTGG + Intergenic
1165272382 19:34722329-34722351 CTTTGGTTTGGAAAGGGGAGGGG - Intergenic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1166044927 19:40224454-40224476 GTGGGGTTTGGGAGGGTGGATGG - Intronic
1166119125 19:40674471-40674493 TTGTGGTTTGGCAGGGGTGAGGG - Intronic
1166866003 19:45837840-45837862 TTCTGGTTTGGGAACTGGGAGGG + Intronic
1167964297 19:53131261-53131283 CTGGCGTTGGGGCAGGGGGAGGG - Intronic
1168122632 19:54260748-54260770 GTGTGCTTGGGGAAGGGAGAAGG - Intronic
1168233539 19:55047877-55047899 CTGTGGGTTGGGAGGAGTGAGGG + Intronic
1168323871 19:55528089-55528111 CTTTGGTTTGGTAAAGGAGAGGG + Intergenic
1168509788 19:56965378-56965400 CAGGGGCTGGGGAAGGGGGACGG - Intergenic
1168622114 19:57887994-57888016 CTTTGGTTTAGGAAGGGGAGGGG - Intronic
925422601 2:3724977-3724999 GTCTGGGTTGGGAAGGGAGAGGG + Intronic
925722523 2:6842812-6842834 GAGGGTTTTGGGAAGGGGGAAGG + Intronic
925731887 2:6924925-6924947 CTTTGCTTTGGGAAGGGTGTGGG + Intronic
925732675 2:6931438-6931460 CTGGGTTTTGGGAATGGGGAGGG + Intronic
926047977 2:9724246-9724268 CTGTGTCTTGGGAAGGAGCATGG - Intergenic
926294368 2:11558112-11558134 CTGTGATTTGGGAAGATGGAAGG + Intronic
926498342 2:13619478-13619500 CTGGGGTGGGGGAAGGGGGGAGG + Intergenic
926951867 2:18252068-18252090 CTGTTGTTTGGCAAGTAGGAGGG + Intronic
927039126 2:19210416-19210438 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
927041416 2:19234413-19234435 CAGTGCTTGGAGAAGGGGGAAGG + Intergenic
927153476 2:20208930-20208952 CTGTGGGTGGGGAAGGGGCAAGG - Intronic
927172225 2:20379767-20379789 TTGTGGGGTGGGCAGGGGGAGGG - Intergenic
927955700 2:27205989-27206011 CCGTGGTGTGGGGAGGGGAAGGG - Intronic
928363571 2:30684947-30684969 CTGGGGAGTGGGGAGGGGGAAGG + Intergenic
929492711 2:42410028-42410050 CTTTTGTGTGGGAAGGGGGTGGG - Intronic
929556350 2:42927761-42927783 CCGTTGTTTGGGGAGGGGGTGGG + Intergenic
929818826 2:45257497-45257519 CTCTGGCTAGGCAAGGGGGAGGG - Intergenic
929879042 2:45820883-45820905 CTGGGGGGTGGGAAGGGGGTGGG - Intronic
929926501 2:46216805-46216827 CTCTGGCTTTGGAAAGGGGAGGG - Intergenic
930084025 2:47480134-47480156 ATGGGGGATGGGAAGGGGGAGGG - Intronic
930126487 2:47801810-47801832 TTTTGGTGGGGGAAGGGGGAAGG + Intronic
930771932 2:55137900-55137922 TTGCGGTGTGGGGAGGGGGAGGG - Intergenic
930835401 2:55788259-55788281 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
930838488 2:55819985-55820007 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
931149239 2:59554665-59554687 CTGGGGTTTTCGAAGGCGGAAGG - Intergenic
932173420 2:69577838-69577860 CTGTAGGTTGGGGAGGGGGCAGG + Intronic
932572155 2:72943758-72943780 CTCTGGACTGGGAAGGGGGCAGG - Exonic
932723410 2:74157133-74157155 CTGTGATCTGGGAAGGGGAGAGG - Intronic
932999220 2:76901195-76901217 TAGGGGTTTGGGATGGGGGAGGG - Intronic
933381946 2:81559078-81559100 GTGGGGTTGGGGAAGGGGGGGGG + Intergenic
933529614 2:83490082-83490104 CTGGGGTTGGGGGAGGGGGAGGG + Intergenic
933695326 2:85213140-85213162 CTGTGGCTGGGGTGGGGGGAGGG + Intronic
933871921 2:86574954-86574976 TTGGGGTGTGGGAAGGAGGATGG - Intronic
933928939 2:87128167-87128189 CTGTGTTTTGGTAAGAAGGAAGG - Intergenic
934000273 2:87703953-87703975 CTGTGTTTTGGTAAGAAGGAAGG - Intergenic
934122720 2:88855698-88855720 CACATGTTTGGGAAGGGGGAAGG - Intergenic
934299728 2:91769766-91769788 CTGTGGATTGGGGTGGGGCAGGG + Intergenic
934511683 2:94949573-94949595 GTGGGGTTGGGGGAGGGGGAGGG - Intergenic
934654936 2:96112506-96112528 GGGTGTTTTGGGTAGGGGGAAGG - Intergenic
934680331 2:96278999-96279021 CTGTGGGTTGGAGAGGGAGAAGG + Intronic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
935024068 2:99259523-99259545 CTGTGGTTTGGAAAGGAGAAGGG + Intronic
935928188 2:108093355-108093377 CTTTGCTTTTGGAAAGGGGAAGG - Intergenic
935945619 2:108283722-108283744 CTGTGGGTGGGAATGGGGGAAGG - Intergenic
936097832 2:109547050-109547072 CCCTGGTTGGGGAAGGGGGCTGG - Intronic
936154585 2:110039831-110039853 CTGGGGATGGGGCAGGGGGAGGG + Intergenic
936159743 2:110075784-110075806 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
936184922 2:110295569-110295591 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
936190098 2:110331583-110331605 CTGGGGATGGGGCAGGGGGAGGG - Intergenic
936364006 2:111835234-111835256 CTGTGTTTTGGTAAGAAGGAAGG + Intronic
936477501 2:112852061-112852083 CTTTGGTTTAGGAAGGGGAGGGG + Intergenic
937085420 2:119168778-119168800 CTGAGGTTTGGAGAGGGGAAGGG - Intergenic
937189428 2:120080249-120080271 GTGGGGTTGGGGGAGGGGGAGGG - Intronic
937509998 2:122584425-122584447 ATGGGGTGGGGGAAGGGGGAGGG + Intergenic
937572883 2:123385451-123385473 GTGTGGTGTGGGGAGGGGGAAGG + Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937651892 2:124328487-124328509 CTGGGGTGTGAGAAGGGAGAAGG - Intronic
937730235 2:125221895-125221917 CTGAGATTTGGGAAGGGCCAGGG - Intergenic
937911196 2:127076376-127076398 CGGTAGTTGGGGGAGGGGGAGGG - Intronic
938595855 2:132786535-132786557 CTGGCATTTGGGAAGGGTGATGG - Intronic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
939443146 2:142275664-142275686 CTGTGCCTTTGGAAAGGGGAAGG - Intergenic
939712614 2:145541765-145541787 GGGTGGTTGGGGATGGGGGATGG + Intergenic
939925810 2:148172466-148172488 CTGGGGTTGGGGAAGGCAGAGGG + Intronic
940658984 2:156523248-156523270 CAGGGGTTAGGGGAGGGGGAAGG - Intronic
940980373 2:159994933-159994955 CTGTGGTGTGGGATGTGGGGTGG + Intronic
941003232 2:160222524-160222546 ATGTGGGTGAGGAAGGGGGATGG - Intronic
941123851 2:161562353-161562375 ATGAGATTTGGGAAGGGGCAGGG + Intronic
942431837 2:175920295-175920317 ATGGGGTGGGGGAAGGGGGAGGG + Intergenic
942858863 2:180585761-180585783 CTGGGGTTGGGGAAGGGGGGAGG - Intergenic
943013903 2:182487646-182487668 CTGTGGTTGGGGTGTGGGGATGG + Intronic
943549861 2:189325166-189325188 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
943942122 2:194011586-194011608 GTGGGGTTGGGGGAGGGGGAAGG + Intergenic
944187657 2:196967299-196967321 CTGCGGTTGGGGAAGGGAAAGGG - Intronic
944442001 2:199752222-199752244 CTGTGGGGTGGGGAGGGAGAGGG - Intergenic
944459289 2:199929186-199929208 GTGGGGTTGGGGGAGGGGGAAGG + Intronic
944516945 2:200521869-200521891 CTGTGGTTTAGGCAAGGGCAGGG - Intronic
945730357 2:213524931-213524953 CTGTGATTTGGGAAGGGTCAGGG + Intronic
945874094 2:215258956-215258978 GTGTGGTGGGGGCAGGGGGAAGG + Intergenic
946028299 2:216685747-216685769 CAGTGGTTGTGGCAGGGGGAAGG + Intronic
946246964 2:218393309-218393331 CTGGGGGGTGGGAGGGGGGAAGG - Intronic
946283422 2:218683726-218683748 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
946295961 2:218783685-218783707 CTAAGGTTGGGGAAGAGGGAGGG + Intronic
946335289 2:219031618-219031640 CTGTGGTTTGAGAAAGCGGAGGG - Exonic
946705118 2:222450747-222450769 CTGGGGTTTGAAAAGGGGGTTGG + Intronic
946719617 2:222590364-222590386 ATGGGGTGGGGGAAGGGGGAGGG + Intronic
947136943 2:226984917-226984939 CTGGGGGTTGGGGTGGGGGAGGG + Intronic
947155514 2:227159311-227159333 ATGGGGTTTGGAAAGAGGGATGG + Intronic
947242833 2:228015067-228015089 CTGTTGTGGGGGAGGGGGGAGGG - Intronic
947273574 2:228367065-228367087 GTGGGGTCGGGGAAGGGGGAGGG - Intergenic
948299898 2:236897118-236897140 TAGAGGTTTGGGAAGGAGGAGGG + Intergenic
948738587 2:240026981-240027003 CCTTGGTTTAGGAAGGGGGGGGG + Intergenic
948790175 2:240372772-240372794 CTGTGGTGGGGGGAGGGGCATGG + Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948964101 2:241362933-241362955 CTGTGGTTCTGGGAGGTGGAGGG + Intronic
949062989 2:241972155-241972177 CTGTGGCCTGGGAAGGTGGGTGG + Intergenic
1169290371 20:4344485-4344507 CTGGGATTTGGGAAGGGGTCAGG + Intergenic
1169779816 20:9296857-9296879 GTGGGGTTGGGGGAGGGGGAAGG + Intronic
1169891533 20:10458512-10458534 CTGTTGTGGGGGAAGGGGGAGGG - Intronic
1169927637 20:10799500-10799522 CTGGGATTAGGGAAGGGAGAGGG - Intergenic
1170271402 20:14531081-14531103 TTGTGGTTTGGGGACAGGGAAGG + Intronic
1170422736 20:16208633-16208655 AGGTTGCTTGGGAAGGGGGAGGG + Intergenic
1170431294 20:16279117-16279139 CTGCTGTTTGGGAAGGGAAATGG - Intronic
1170670309 20:18426721-18426743 ATGGGGTGTGGGAAGGTGGAGGG + Intronic
1170742027 20:19066610-19066632 CAGGGGTGGGGGAAGGGGGATGG - Intergenic
1171036095 20:21714045-21714067 CTGGGGTTTGGAAAGGGTGAGGG + Intronic
1171381424 20:24737137-24737159 CTGGGGTATGGGGAGTGGGAAGG - Intergenic
1171389903 20:24794695-24794717 CTGTGGCTTGGGAAGGGCTGAGG - Intergenic
1171973745 20:31580741-31580763 CTGGTGTTTGGGAAGGGGGCAGG - Intergenic
1172049843 20:32109162-32109184 CTGTGAAATGGGAAGGGGGTTGG - Intergenic
1172101166 20:32484403-32484425 GTGCGGATGGGGAAGGGGGAGGG - Intronic
1172569546 20:35958781-35958803 CTGTGGTTAGGGATAGGGGAAGG - Intronic
1172608217 20:36230067-36230089 GTGGGGTGGGGGAAGGGGGAAGG - Exonic
1172811233 20:37649731-37649753 CTGAGGGTTGGGTCGGGGGAAGG + Intergenic
1173310865 20:41894963-41894985 CGGTGGATGGGGAAGAGGGATGG + Intergenic
1173977782 20:47200327-47200349 CTTTGGTTTAGAAAGGGGGGGGG - Intergenic
1174296035 20:49545834-49545856 CTGCTGTTTGGGAAGTAGGATGG + Intronic
1174296039 20:49545858-49545880 CTGCTGTTTGGGAAGTAGGATGG + Intronic
1174736623 20:52971923-52971945 CTCGGGGCTGGGAAGGGGGAGGG - Intergenic
1175177698 20:57122912-57122934 CCATGGTTTGGAATGGGGGAGGG - Intergenic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175450663 20:59063672-59063694 TTGTGGTTTGGGAATTAGGAGGG - Intergenic
1175575049 20:60054758-60054780 CTGAGGTTGGGGCCGGGGGATGG + Intergenic
1175685630 20:61026194-61026216 CTGTTGTGGGGGAACGGGGAGGG - Intergenic
1175765346 20:61588621-61588643 GTGTGGTCTCGGGAGGGGGAGGG - Intronic
1175779940 20:61675973-61675995 CTGTGCTCTGGGCAGGAGGAGGG - Intronic
1176041103 20:63066287-63066309 CTAGGGTTTGGGATGGGGGATGG + Intergenic
1176314130 21:5225878-5225900 CTGAGGTTTGGTAGGGAGGAAGG - Intergenic
1177119663 21:17124321-17124343 CTTTGGTTTGGGAAGAAGGGTGG - Intergenic
1177597558 21:23265655-23265677 CCATGGATTGGGGAGGGGGATGG - Intergenic
1179143140 21:38744863-38744885 CAGTGTTTTGGGGAGGGGGGAGG - Intergenic
1179153829 21:38832449-38832471 CTGTGGCTTGGGAATAGGGGAGG + Intergenic
1179315253 21:40238218-40238240 CTGTGGTCTGGAAAGTGGAATGG + Intronic
1179499494 21:41798533-41798555 CTGTGGGTTGAGAAGGGGCTCGG - Intronic
1179604470 21:42504919-42504941 GATTGGTTGGGGAAGGGGGAAGG - Intronic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180318058 22:11294254-11294276 GTGAGGTGTGGGAGGGGGGAAGG + Intergenic
1180337246 22:11589159-11589181 GTGGGGTGTGGGAGGGGGGAAGG - Intergenic
1180391942 22:12291997-12292019 CTGAGGTTTGGTAGGGAGGAAGG - Intergenic
1180407802 22:12572759-12572781 CTGAGGTTTGGTAGGGAGGAAGG + Intergenic
1180524391 22:16241028-16241050 GTGGGGTTGGGGGAGGGGGAGGG + Intergenic
1180581632 22:16844544-16844566 CTGGAGTTTGGGAGGTGGGAGGG + Intergenic
1181043501 22:20203960-20203982 CTGTGGAATGGGAAGTGGGGAGG + Intergenic
1181556266 22:23673427-23673449 CTGTGGATTGGGGTGGGGCAGGG - Intergenic
1181698083 22:24603862-24603884 CTGTGGATTGGGGTGGGGCAGGG + Intronic
1181805232 22:25370567-25370589 CTGTGGTTTGGGGGTGGGCAGGG - Intronic
1182465814 22:30515507-30515529 CTGTGGCTTGGGAAAGGCCAGGG - Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182642619 22:31780611-31780633 GAGTGGCTTGGGAAGGGGAAAGG - Intronic
1182736149 22:32533248-32533270 TTGAGGATTTGGAAGGGGGATGG - Intronic
1182762926 22:32737457-32737479 GTGGGGTTGGGGGAGGGGGAGGG - Intronic
1182970557 22:34570872-34570894 CTGTGGTTGTGGGAGGGGGCTGG - Intergenic
1183548662 22:38468718-38468740 GTGGGGTCTGGGAAGGGGCAGGG - Intronic
1183597154 22:38819437-38819459 CTGTGGGCTGGGAAAGGGGTCGG + Exonic
1183824278 22:40372453-40372475 GTGTGGTCTGGGAGGGGAGAGGG + Intronic
1183847502 22:40554276-40554298 CTGTGATTTGGGAGGGGCCAGGG + Intronic
1184172083 22:42765754-42765776 CTGGGGTGTGGGTAGGGTGAGGG - Intergenic
1184272779 22:43394095-43394117 CAGTGGGTTGGGAAGAGGGGTGG + Intergenic
1184525983 22:45023106-45023128 CTGTGGCTTGGAAAAGGAGATGG - Intergenic
1184685948 22:46096419-46096441 CTGTGGGATGGGAAGAGGGTCGG + Intronic
1184876618 22:47280009-47280031 CTGTAGTTAGGGAAAGGGGACGG + Intergenic
1184995729 22:48206026-48206048 CTCTGGATTGGGAAGAGGGGTGG + Intergenic
1185332526 22:50258097-50258119 CAGTGGTATGGGGAGGGGGTGGG + Intronic
1185392272 22:50569016-50569038 CTGTGGTCTGAGCTGGGGGAGGG + Exonic
949978921 3:9487605-9487627 CTGAGGTTAGGGGAGAGGGAAGG + Intergenic
950158478 3:10741689-10741711 ATGTGCTTTGGGAATAGGGAAGG + Intergenic
950578706 3:13849074-13849096 CTGGGGATTCGGAAGGGGAAGGG + Intronic
950674448 3:14546129-14546151 CTGTGGGTGGGGTAGAGGGAGGG + Intergenic
951042143 3:17999835-17999857 GTGGGGTTGGGGGAGGGGGAGGG - Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
951259039 3:20484462-20484484 CTGTGGTTTGAGAAAGTGGCTGG - Intergenic
951413537 3:22395411-22395433 GTGGGGTTGGGGGAGGGGGAAGG - Intergenic
951457501 3:22908960-22908982 CTGTGATTTTGGAAGTGTGATGG - Intergenic
951769427 3:26239222-26239244 GTGGGGTTGGGGGAGGGGGAAGG - Intergenic
951877112 3:27439784-27439806 CTGTGATTTGGGAAAAGGAAAGG - Intronic
952036788 3:29212493-29212515 ATGAGGTTTGGGAAGGGCCAGGG + Intergenic
952106524 3:30076457-30076479 CTGTAATGGGGGAAGGGGGAAGG - Intergenic
952114689 3:30164359-30164381 ATGAGGTATGGGAAGGGTGAAGG + Intergenic
952683996 3:36129358-36129380 CTGTAGTTTGGCAAGCGGGAGGG - Intergenic
952686480 3:36155049-36155071 CTGTGGTTCTGGCAGGAGGAAGG + Intergenic
953166114 3:40466246-40466268 GTGTGGATTGGGTTGGGGGATGG + Intergenic
953219262 3:40954010-40954032 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
953556793 3:43952404-43952426 CAGTGGCTTGGGATGGGGCAGGG - Intergenic
953801614 3:46028256-46028278 CTGTTGTTTGGTGAGTGGGAGGG - Intergenic
953990803 3:47481698-47481720 CTTTGGTTTGGCAAGGGGAAGGG + Intergenic
954461363 3:50628845-50628867 CTGGGGCTTGGGAAGGTGAAAGG + Intronic
954503680 3:51047256-51047278 ATGAGGTTGGGGGAGGGGGAGGG + Intronic
954713288 3:52515369-52515391 CAGTGGCTTGGGCAGGGGCAGGG - Intronic
954796160 3:53162133-53162155 GGGTGGGGTGGGAAGGGGGATGG - Intronic
955162638 3:56479791-56479813 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
955688498 3:61567427-61567449 CAGTGCTTTGGGAGGCGGGAGGG + Intronic
955919291 3:63938491-63938513 CTCTGGTTTGGAAAGGGGAGGGG - Intronic
956056158 3:65301050-65301072 GTGAGGTATGGGAAGGGGTATGG + Intergenic
956159846 3:66338706-66338728 CTGTAGTTTGGCTAGGGGAAGGG - Intronic
956432410 3:69200473-69200495 CTGCCGTCTGGGAGGGGGGAGGG - Intronic
956613722 3:71150571-71150593 TTGTGCTTTGGGAAGTTGGAGGG - Intronic
956940596 3:74157104-74157126 TTGTGGGGTGGGGAGGGGGAGGG - Intergenic
957259097 3:77877404-77877426 GTGGGGTTTGGGGAGGGGGGAGG - Intergenic
957392333 3:79592897-79592919 CTAGGGGTTCGGAAGGGGGAGGG - Intronic
957762971 3:84583683-84583705 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
957801982 3:85097141-85097163 GTGGGGTGTGGGGAGGGGGAAGG - Intronic
957894447 3:86403309-86403331 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
957980582 3:87504654-87504676 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
958410231 3:93807163-93807185 GTGGGGTGTGGGGAGGGGGAGGG + Intergenic
958744208 3:98113471-98113493 ATGTGTCTTGGGAAGGTGGAGGG - Intergenic
959014234 3:101114313-101114335 TTGGGGTGGGGGAAGGGGGAAGG + Intergenic
959807599 3:110575846-110575868 GTGTGGTTTGGGCAGGGAGTAGG - Intergenic
959894605 3:111592081-111592103 ATGTGGGTTGGGAATGGGGATGG - Intronic
960779877 3:121308099-121308121 CTGTTGTTGGAGCAGGGGGAGGG + Intronic
960863023 3:122171123-122171145 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
961048764 3:123728561-123728583 TTGTTGTTTGGGAGGGTGGAGGG - Intronic
961345286 3:126260116-126260138 ATGTGGAGAGGGAAGGGGGAGGG - Intergenic
961413855 3:126743329-126743351 CTGTGATTTGGTAATGGGGGAGG - Intronic
961439867 3:126946236-126946258 CTGGGCTTTGGCAAGGCGGAAGG - Intronic
961455202 3:127020555-127020577 CTGGGGTTGGGGCAGGGGAATGG + Intronic
961549840 3:127663020-127663042 GTGTGTTTTGGGGAGGGAGAAGG - Intronic
962083459 3:132165519-132165541 CTTTGGTTAGGGGAGGTGGATGG - Intronic
962160359 3:132992762-132992784 CTGTGGTTTGGGAAAGAGCAGGG + Intergenic
962298989 3:134220409-134220431 CTGACGTATGGGGAGGGGGAGGG + Intronic
962355649 3:134692251-134692273 ATGGGGTTGGGGGAGGGGGAAGG - Intronic
962441924 3:135427894-135427916 GTGGGGTTGGGGAAGGGGGGAGG + Intergenic
962471039 3:135709303-135709325 CTGTTTTTTGGGAGGAGGGATGG - Intergenic
962642881 3:137406717-137406739 GTGTGTTTTGGGTTGGGGGAGGG + Intergenic
962741222 3:138363821-138363843 CTGTGGTTTGGGGGGGGGGGGGG - Intronic
962841917 3:139241317-139241339 CTGCGGGGTGGGGAGGGGGAAGG - Intronic
962966994 3:140364642-140364664 CTGGGGTCTGGGAAGGGGCTTGG + Intronic
963101088 3:141604755-141604777 CTGGGGTGTGGGGAGGGGGGAGG + Intronic
963248287 3:143082907-143082929 CTGAGGTGGGGGAAGGGGGGTGG - Intergenic
963316281 3:143762190-143762212 GTGGGGTTGGGGGAGGGGGAAGG + Intronic
963415751 3:144993793-144993815 GTGGGGTTGGGGAAGGGGGGAGG - Intergenic
963706063 3:148689907-148689929 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
963824999 3:149943953-149943975 GTGGGGTTGGGGGAGGGGGAGGG - Intronic
964294607 3:155219719-155219741 CTGTTGTGGGGGATGGGGGAGGG - Intergenic
964342201 3:155719365-155719387 GTGGGGTTGGGGGAGGGGGAAGG + Intronic
964645139 3:158950937-158950959 CTGTGGGTTGGGAAGGGTCAGGG - Intergenic
965094740 3:164210649-164210671 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
965366220 3:167803126-167803148 GTGGGGTTGGGGGAGGGGGAGGG + Intronic
966283958 3:178270888-178270910 CTCAGGGTTGGGAAGGAGGAAGG + Intergenic
966878154 3:184335289-184335311 CTGTTGCCTGGGCAGGGGGAAGG + Exonic
966882098 3:184356290-184356312 CTGAGGATTGGGAGTGGGGAGGG - Intronic
967049143 3:185766015-185766037 CTTTGGTTTTGGAAAAGGGATGG - Intronic
967495079 3:190134130-190134152 CTTTGGTTTGGAAAGTGGGGGGG - Intergenic
967602753 3:191409073-191409095 GTGGGGTGTGGGGAGGGGGAGGG + Intergenic
967754191 3:193149845-193149867 CTGGGGTTGGGGGAGGGGGGAGG + Intergenic
968205558 3:196796412-196796434 CTGAGGTTTGGGGTGGGGCAAGG + Intronic
968287080 3:197515027-197515049 CTGTGCCTTGGGAAGGAGCACGG - Intronic
968589499 4:1450333-1450355 CTGAGCTCTGGGAAAGGGGAGGG + Intergenic
968913889 4:3488839-3488861 CTGTGGATGTGGAAGGGGCAGGG + Intronic
969098231 4:4750370-4750392 GTGTGGCTTGGGAAGGGGCGTGG - Intergenic
969259999 4:6027409-6027431 CTGAGGCCTGGGAAGAGGGAAGG + Intronic
969455322 4:7296958-7296980 CTGGTGTCTGGGGAGGGGGAAGG - Intronic
969470862 4:7388546-7388568 CTGTGGGTGGGGAAGCGGGGAGG - Intronic
969542692 4:7803535-7803557 CTGTGGTTGGGGATCGGGGCCGG - Intronic
970096363 4:12467289-12467311 GTGGGGTTTGGGGAGGGGGATGG + Intergenic
970652431 4:18193493-18193515 GTGTGTATTGGGTAGGGGGAAGG - Intergenic
970719203 4:18966401-18966423 GTGGGGTTGGGGAAGGGGGGAGG + Intergenic
971485622 4:27157028-27157050 CTGTGGTCTAGGAATGGGGCTGG - Intergenic
972073550 4:35054951-35054973 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
972116056 4:35635017-35635039 GTGGGGTTGGGGGAGGGGGAGGG + Intergenic
972287016 4:37658967-37658989 CTGTGATTTGGGAGTTGGGAGGG - Intronic
972377086 4:38482386-38482408 GTGGGGTTGGGGGAGGGGGAAGG + Intergenic
973931153 4:55793926-55793948 CTGGGGATGGGGAAGAGGGACGG + Intergenic
974521532 4:62987186-62987208 CTGTGCTGTGGGCAGTGGGAAGG - Intergenic
974554599 4:63428550-63428572 ATGGGGTTTGGGGAGGGGGAGGG - Intergenic
975529722 4:75387691-75387713 TTGTGGGTTGGGGAGGGGGTAGG - Intergenic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
975927976 4:79482732-79482754 CTGGGGTGGGGGAAGGGGGGAGG + Intergenic
976451330 4:85194603-85194625 GTGGGGTTGGGGAAGGGGGAGGG + Intergenic
976772949 4:88674135-88674157 CTGGGGTGTGGGAAGGGGTCAGG + Intronic
977140199 4:93361983-93362005 GTGGGGTGGGGGAAGGGGGAAGG - Intronic
977308416 4:95354359-95354381 CTGTGTTTTTGGAATGTGGAGGG - Intronic
977986759 4:103391378-103391400 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
978194581 4:105956286-105956308 TTGGGGTTGGGGAAGAGGGAGGG - Intronic
978417258 4:108489564-108489586 CTGGGCTTTGCGAAGGGGAAGGG - Intergenic
979096125 4:116553427-116553449 CTGTGGTGTGGGGAGGGCAAAGG + Intergenic
979751712 4:124287596-124287618 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
979948255 4:126860995-126861017 CTGTGGTGGGGGGAGGGGGGAGG - Intergenic
980081033 4:128344347-128344369 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
981155832 4:141433813-141433835 ATGGGGTTGGGGGAGGGGGAAGG - Intergenic
981265805 4:142782124-142782146 GTGGGGTGTGGGAAGGGGGGAGG - Intronic
981681779 4:147407835-147407857 CTGTGGTTTAGGAGGTGGGGAGG - Intergenic
981936476 4:150245509-150245531 ATGGGGTAGGGGAAGGGGGAGGG - Intronic
983272917 4:165584161-165584183 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
983320344 4:166189342-166189364 CAGTAGTTTGGCAAGTGGGAGGG + Intergenic
984574674 4:181434497-181434519 GTGGGGTTGGGGGAGGGGGAGGG - Intergenic
984952734 4:185019083-185019105 GAGTGGTTTGGGAAGGGGGTGGG + Exonic
985122989 4:186662075-186662097 TTGAGGTTTGGGAAGAGGGTAGG + Intronic
985227437 4:187777857-187777879 TTGTTGTTTGGCAAGTGGGAGGG + Intergenic
985266881 4:188159189-188159211 CTGTCGGTGGGGCAGGGGGAGGG - Intergenic
985432984 4:189899474-189899496 CTGAGGTTTGGTAGGGAGGAAGG + Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985759895 5:1743106-1743128 CTGTGCTTTAGGCAGGGGAAAGG - Intergenic
986128964 5:4909719-4909741 ATGAGGTTTGGGAAGGGCCAGGG - Intergenic
986280339 5:6316998-6317020 CTGGGGATTGGGGAGTGGGAGGG - Intergenic
987626413 5:20406427-20406449 CTGTTGTGGGGGAGGGGGGAGGG + Intronic
988123827 5:27002769-27002791 GTGGGGTTGGGGGAGGGGGAGGG + Intronic
988166445 5:27596166-27596188 CTGGGTTTTGGGGAGGGGGGTGG + Intergenic
988958512 5:36345142-36345164 CTGAGAGTTGGGAATGGGGAGGG + Intergenic
989192111 5:38680694-38680716 CTTTGGGGTGGGATGGGGGATGG - Intergenic
989489353 5:42032467-42032489 CTCTGCCTTGGGAAGTGGGAGGG - Intergenic
989495293 5:42104903-42104925 CTGTGGTTTGAGAATGTGGTTGG + Intergenic
989745490 5:44824649-44824671 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
990147278 5:52776234-52776256 CAGTGGTTTGAGATGGGGGAGGG - Intergenic
990541395 5:56776451-56776473 GAGGGGTGTGGGAAGGGGGAAGG - Intergenic
991647400 5:68815036-68815058 CTGTGGCCTTGGCAGGGGGAGGG - Intergenic
991654161 5:68886367-68886389 CTGGGGTGGGGGTAGGGGGAGGG - Intergenic
992342531 5:75840127-75840149 TTGTGGGTTGGGGAGGGGGAGGG - Intergenic
992625775 5:78634698-78634720 CTTTGGATTGGAAAGGGTGAGGG - Intronic
993435590 5:87889008-87889030 CTGGGGTTGGGGAAGGGGTGGGG + Intergenic
993663042 5:90662753-90662775 GTGTGGTGGGGGGAGGGGGAAGG - Intronic
994530016 5:100957106-100957128 CTCTGCTTTTGGAAAGGGGAGGG + Intergenic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
994651485 5:102534593-102534615 CAGAGGTTTGGGCAGGAGGAAGG + Intergenic
995169786 5:109094049-109094071 CAGTGGGTTGTGAATGGGGAGGG + Intronic
996012450 5:118495882-118495904 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
996256273 5:121408039-121408061 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
996276690 5:121675168-121675190 GTGGGGTTGGGGGAGGGGGAAGG + Intergenic
996536238 5:124581000-124581022 CTGAGCTTTGGGGAAGGGGAGGG - Intergenic
996758296 5:126959122-126959144 CTATAGTATGGAAAGGGGGAAGG + Intronic
997000821 5:129759623-129759645 TTATGCTTTGGGCAGGGGGAGGG + Intronic
997046139 5:130320445-130320467 CTGTGGTTGGGTAGGGGAGAGGG + Intergenic
997104762 5:131005960-131005982 CTCTGGTTATGGAAAGGGGAGGG + Intergenic
997161213 5:131611076-131611098 CAGTGGTTTAGCAAGGTGGAAGG - Intronic
997261079 5:132465888-132465910 CAGTGGTTTTTAAAGGGGGAGGG + Intronic
997500136 5:134367273-134367295 CTGTGCTTGGGAATGGGGGAGGG + Intronic
997508004 5:134433655-134433677 CTTTTGTTTTGGAATGGGGATGG + Intergenic
998031120 5:138868985-138869007 GGGTGTTTTGGGAGGGGGGAGGG - Exonic
998158540 5:139799879-139799901 CAATGGCTTGGGAAGGGAGATGG + Intronic
998213954 5:140223425-140223447 CTGAGGTTTGGAAAGGTGAAGGG + Intronic
998434443 5:142095610-142095632 CTGTGTTTTGGAAGGGAGGAGGG + Intergenic
998541319 5:142984144-142984166 CTGTGGTTCAGGCAGGGAGAAGG + Intronic
998861404 5:146447536-146447558 ATGGGGTTTAAGAAGGGGGAAGG + Intronic
998925975 5:147127055-147127077 ATGCGGTTTGAGAAGGGGCAAGG - Intergenic
999039568 5:148392405-148392427 CTTTGTTTTGGGGAGGGGGAGGG + Intronic
999177562 5:149642050-149642072 CTCTGGTGTGGGAGGTGGGATGG - Intergenic
999297013 5:150466067-150466089 GTCTGGTTTGGGGAGGGAGATGG - Intergenic
1000749905 5:165082060-165082082 GTGGGGTTGGGGGAGGGGGAAGG - Intergenic
1001275466 5:170347723-170347745 ATCTGGTCTGGGAAGGGAGACGG - Intergenic
1001867893 5:175121316-175121338 ATGTGGCTTGGTAAAGGGGATGG - Intergenic
1001952139 5:175823824-175823846 GAGTGGTTTGAGGAGGGGGAGGG - Intronic
1002055075 5:176594101-176594123 CTGTGGACTGGGAAGGGGCAGGG + Intronic
1002101074 5:176857929-176857951 GTGGGGTTTGGGAAGTGGCAGGG + Intronic
1002194528 5:177494882-177494904 CTGGGGTCAGGGGAGGGGGAGGG + Intronic
1002300643 5:178255703-178255725 CTGTGACTGGGGACGGGGGAGGG - Intronic
1002866701 6:1128140-1128162 GTGTGGTTTGGGGATGGGGCTGG + Intergenic
1003016734 6:2474043-2474065 CTGGGGTTTGGGAAGAGAAATGG - Intergenic
1003230896 6:4252819-4252841 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
1003273161 6:4624761-4624783 CTGTGTTTTGGGGTGGGGGGCGG + Intergenic
1003612593 6:7627099-7627121 CTGTGGTCTGGTCAGGAGGAAGG - Intergenic
1003637297 6:7844601-7844623 CTGCGGGTGGGGAAGGGGGGTGG - Intronic
1003649226 6:7943325-7943347 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1003730205 6:8813094-8813116 GTGGGGTTGGGGAAGGGGGGAGG + Intergenic
1003817847 6:9862182-9862204 ATGAGATTTGGGAAGGGGCAGGG - Intronic
1003973335 6:11320304-11320326 TTGTGGCTTGGGAAGTGAGAGGG + Intronic
1004644401 6:17545688-17545710 GTGAGGTTGGGGGAGGGGGAGGG - Intronic
1005222077 6:23598233-23598255 CTGGGGTGGGGGAGGGGGGAAGG + Intergenic
1006084802 6:31587973-31587995 CTGGGGACAGGGAAGGGGGAGGG + Intronic
1006171791 6:32097306-32097328 CTGAGGGTGGGGAAGAGGGAGGG + Intronic
1006334875 6:33415250-33415272 CTCTGGTTAGGGCTGGGGGATGG - Exonic
1006669180 6:35719036-35719058 CTGTGAGTTGGGAGGGGGCAAGG - Intronic
1007155836 6:39742404-39742426 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1007371611 6:41429879-41429901 CTGTGGTTTGAAGAGGGAGAGGG - Intergenic
1007961115 6:45960493-45960515 CTGTGGTGTGGGCTGGGGGTGGG + Intronic
1008400565 6:51058004-51058026 GTGTGGTGGGGGGAGGGGGAAGG - Intergenic
1008560127 6:52715647-52715669 TCGTGGTTTGGGAATTGGGAAGG + Intergenic
1008605665 6:53137107-53137129 CTGTGGTTTGGGAAGGGGGAAGG + Intronic
1009242552 6:61199506-61199528 CTGAGATTTGGGAAGGGCCAGGG + Intergenic
1009260227 6:61476820-61476842 GTGGGGTTGGGGGAGGGGGAGGG + Intergenic
1009683084 6:66923860-66923882 TTGTGGTATGGGAAAAGGGAAGG + Intergenic
1011242104 6:85283431-85283453 CCATGGATTGGGATGGGGGAGGG - Intergenic
1011355910 6:86473393-86473415 CCTTGGTTTAGGAAGGGGGGGGG - Intergenic
1011427009 6:87240369-87240391 CGGTGGGTGGGGGAGGGGGAGGG + Intronic
1011901393 6:92302457-92302479 CTCTGCTTTTGGAAAGGGGAGGG + Intergenic
1012609191 6:101194445-101194467 ATGTGGTCGGGGAAGGGGGGAGG + Intergenic
1013014951 6:106152482-106152504 ATGAGATTTGGGAAGGGCGAGGG + Intergenic
1013033199 6:106356246-106356268 CTGTAGTTTGGAAACGAGGAAGG - Intergenic
1013067822 6:106700572-106700594 CTTTGGTCTGGGTATGGGGAGGG - Intergenic
1013690331 6:112634071-112634093 TTGTGGGGTGGGGAGGGGGAGGG + Intergenic
1013803270 6:113970751-113970773 CTGAGGGGTGGGAAGGAGGAGGG - Intronic
1013855074 6:114562739-114562761 CTGTGGTTTGAGAAGGTGCAGGG + Intergenic
1014422862 6:121266905-121266927 CTGTCGGTGGGGAAGGGGCAAGG + Intronic
1014629551 6:123772188-123772210 CTGTCGTTTAGGAGGAGGGAGGG - Intergenic
1014920840 6:127213347-127213369 CTTTTTTTTGGGCAGGGGGAGGG + Intergenic
1015377595 6:132528084-132528106 CTCTTTTTTGGGTAGGGGGACGG + Intergenic
1015438238 6:133215970-133215992 CTGTGGGTTGGGAAGATGGGAGG - Intergenic
1015616958 6:135087515-135087537 TTATGGGTTGGGAAGGGGAAGGG - Intronic
1015626404 6:135183359-135183381 CTGGGGGTTAGGAAGAGGGAGGG - Intronic
1015627488 6:135195731-135195753 CTGTGTCTAAGGAAGGGGGAAGG - Exonic
1015959499 6:138632130-138632152 CTCTGCCTTGGGAAAGGGGAGGG + Intronic
1016223033 6:141699174-141699196 CTGTAGTTTGGTGAGGGGGAGGG - Intergenic
1016741409 6:147533071-147533093 CCTTGGGTTGGGAAGGGGGCTGG + Intronic
1017071131 6:150576411-150576433 CTGGCGTATGGGAAGGAGGAAGG + Intergenic
1017227096 6:152034140-152034162 GTGTGGTTGGGGAGGGGGGAGGG + Intronic
1017543487 6:155426837-155426859 ATCTGGTTTGTGAAGGGGAAGGG + Intronic
1017737747 6:157380341-157380363 CTGTCGGGTGGGAAGGGGGGAGG + Intergenic
1017837734 6:158194371-158194393 CTTTGGTTTAGGAAGGGGACGGG + Exonic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1018077706 6:160231323-160231345 CTTTGGGTTGGGAAGAAGGACGG - Intronic
1018270732 6:162074479-162074501 GTGTGGTGGGGGGAGGGGGAGGG + Intronic
1018487470 6:164256537-164256559 CTGTGGCTAGTCAAGGGGGAGGG - Intergenic
1018743497 6:166747583-166747605 CTGTGTGGTGGAAAGGGGGAAGG - Intronic
1018744209 6:166749876-166749898 CTGTGTGGTGGAAAGGGGGAAGG - Intronic
1018890199 6:167977310-167977332 CTCCGGTGTGGGAGGGGGGAGGG - Intergenic
1019417045 7:932569-932591 CTGTTGTCCGGGGAGGGGGATGG + Intronic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019851324 7:3561073-3561095 CTAGGGGTGGGGAAGGGGGAAGG - Intronic
1020087228 7:5317038-5317060 CTGGCGTTTGGGAAGAGGGCTGG - Intronic
1020132933 7:5569842-5569864 CTGGGGTGGGGGATGGGGGATGG - Intergenic
1020339947 7:7099545-7099567 CTGTGGGGTGGGAGTGGGGATGG - Intergenic
1020907749 7:14085672-14085694 CTGTGCTTCTGGAAGGGAGAAGG - Intergenic
1021303852 7:19006725-19006747 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1021478591 7:21090920-21090942 GTGGGGTTGGGGGAGGGGGAAGG + Intergenic
1022628108 7:32059221-32059243 GTGTGGTTTGGGGGTGGGGATGG + Intronic
1023109010 7:36791543-36791565 GTGTGGCTTGGGAAGGAGGCAGG + Intergenic
1023258218 7:38332640-38332662 CTTTGGTTTGGAAAGGGGAGGGG - Intergenic
1023481932 7:40643999-40644021 CTGTCGTTTGGGATGGGTGCGGG + Intronic
1023522815 7:41065845-41065867 CTGTGGGTGGGGAAGGCGGGAGG + Intergenic
1023891634 7:44396565-44396587 CTGGAGTTTGGGAAGGAGAAAGG - Intronic
1024049495 7:45609773-45609795 CTGAGGTCTAGGAAGGGGAAAGG + Intronic
1024759881 7:52582956-52582978 TTGTGCTTTGGGCAGGGGGAGGG + Intergenic
1024924244 7:54596398-54596420 CTGTGGTTTGGCAAAGAGAAGGG - Intergenic
1025134708 7:56401299-56401321 GTGGGGTTGGGGAAGGGGGAGGG + Intergenic
1025664863 7:63576770-63576792 CTGGCGTTTGGGAAGAGGGCTGG - Intergenic
1026101838 7:67390270-67390292 CTGTGCTGTGGGAAGGGGAGGGG - Intergenic
1026197826 7:68188241-68188263 GTGTGTGTTGGGAAGGGAGAGGG - Intergenic
1026580077 7:71608353-71608375 CAGGGGTTGGGGGAGGGGGAAGG + Intronic
1027233924 7:76286864-76286886 CTGTGGTCTGGGACGTGGGCTGG + Exonic
1027270424 7:76515646-76515668 CTGATGTGTGGGATGGGGGACGG - Intronic
1027617703 7:80444240-80444262 ACGTGGTTGGGGAAGGGGAAGGG - Intronic
1027659251 7:80969309-80969331 TGGGGGTTTGGGCAGGGGGAAGG + Intergenic
1027935005 7:84590590-84590612 GTGGGGTAGGGGAAGGGGGAGGG - Intergenic
1028278816 7:88894829-88894851 CAGAGGTTTGGGGAGGGGGGTGG + Intronic
1028651251 7:93152528-93152550 GTGGGGATTGGGAAGGGGGGGGG + Intergenic
1028720173 7:94020889-94020911 ATGGGGTTGGGGGAGGGGGAGGG + Intergenic
1028746040 7:94327789-94327811 GTGGGGTGTGGGGAGGGGGAGGG + Intergenic
1028999072 7:97134092-97134114 CTGAGCTTTGGAAAGGGGGGAGG - Intronic
1029153994 7:98502041-98502063 CAGTGCATTTGGAAGGGGGATGG + Intergenic
1029317266 7:99726095-99726117 CTTTGGGTTGGGAAGAAGGATGG - Intronic
1030268583 7:107646471-107646493 GTGGGGTTGGGGGAGGGGGAGGG - Intergenic
1030433988 7:109491414-109491436 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1030670148 7:112326363-112326385 GTGTGTTTTGGGGTGGGGGAAGG - Intronic
1030683749 7:112461077-112461099 CTTTTGTTTGGGGAGGGGAAGGG - Intronic
1031143311 7:117969549-117969571 GTGGGGTTGGGGAAGGGGGCAGG + Intergenic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1033066814 7:138163927-138163949 GTGTGCATTGGGAAGTGGGATGG + Intergenic
1033101329 7:138475167-138475189 TTGTGGTATGGGAATGGTGAGGG + Intronic
1033360801 7:140637767-140637789 CTGTGGTCTGAGAAGGGGACAGG - Intronic
1033408075 7:141089859-141089881 GTGGGGTTGGGGGAGGGGGAGGG + Intronic
1033418584 7:141185812-141185834 CTGTGATATGGAAAGGGGGAAGG - Intronic
1034175879 7:149099395-149099417 CTGTGAATTTGGAAAGGGGAGGG + Intergenic
1034211627 7:149368683-149368705 CTGTTGTAGGGGGAGGGGGAGGG - Intergenic
1034581923 7:152050938-152050960 CTGTGTTTGGGGGAGGGAGAGGG - Intronic
1034988693 7:155533952-155533974 CTGAGGTTTGGGAGGGGGAGGGG + Intergenic
1035243319 7:157546425-157546447 CTGTCAGTGGGGAAGGGGGATGG - Intronic
1035398553 7:158550469-158550491 CTGAGGTCTGGGCAGGGAGAGGG + Intronic
1035417949 7:158705134-158705156 CGGTGTTGTGGGAAGGAGGAAGG + Intergenic
1035766189 8:2107510-2107532 CTGTGGGCTGGGCAGGAGGATGG + Intronic
1037223488 8:16554538-16554560 CTGAGGTCTGGGAAGGGGAGGGG + Intronic
1037291031 8:17349589-17349611 ATGGGATTTGGGAAGGTGGAGGG - Intronic
1037584808 8:20269082-20269104 CTTTATTTTTGGAAGGGGGAAGG - Intronic
1037749209 8:21669144-21669166 ATGAGGTTTGGGAGTGGGGAAGG + Intergenic
1037899650 8:22680259-22680281 CTGGGGTTTGGGGAGGGATACGG - Intergenic
1038429339 8:27487113-27487135 CAGGGATTTGGGAATGGGGATGG - Intergenic
1038813844 8:30880784-30880806 GTGTGTTTTGGGGAGGGGGTGGG + Intronic
1039595358 8:38786649-38786671 GTGCGGTTTGGGGAGGGGGAGGG + Intronic
1039729838 8:40262701-40262723 GTGGGGTTTGGGGAGGAGGAAGG - Intergenic
1039740406 8:40377760-40377782 CTGAGTTTAGGGAAGGGAGATGG + Intergenic
1039768499 8:40658457-40658479 CGGTGGTGTGGGAATTGGGATGG + Intronic
1040420552 8:47236232-47236254 CAGTGGTTAAGGAAGAGGGAGGG + Intergenic
1040547392 8:48409279-48409301 CTGTGTTATGGTAAGTGGGAAGG - Intergenic
1040607997 8:48954044-48954066 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1041090611 8:54297857-54297879 CTAGGTTTTGGAAAGGGGGAGGG - Intergenic
1041374019 8:57193740-57193762 GTGGGGGTTGGGCAGGGGGAAGG + Intergenic
1041506305 8:58601857-58601879 CTGCAGTTTAGGAAGGAGGAGGG - Intronic
1042140748 8:65676142-65676164 GTGTGTGTTGGGAAGGGGGAAGG - Intronic
1042191796 8:66194551-66194573 CTCTGGTCGGGGAAGGAGGAAGG + Intergenic
1042329520 8:67563569-67563591 CTGGAGTTTGGGTAGGGAGAAGG + Intronic
1042454963 8:68990106-68990128 CTTTGGTTGAGGAAGAGGGAGGG + Intergenic
1043333250 8:79142832-79142854 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1043479291 8:80637049-80637071 CTGGGGGTGGGGGAGGGGGACGG - Exonic
1043627045 8:82274093-82274115 CTGTGCCTTTGGAAAGGGGAGGG + Intergenic
1043744417 8:83855492-83855514 CTGGGGTTGGGGGAGGGGGGAGG + Intergenic
1044179889 8:89178727-89178749 CTTTGGTTTAGGAAGGGGAGGGG + Intergenic
1044217059 8:89624660-89624682 CAGGGGTTTGGGAGGAGGGAAGG - Intergenic
1044235821 8:89828913-89828935 CTGTGGTCAGAGAAGTGGGAAGG + Intergenic
1044499772 8:92939910-92939932 CTGTGGTTGGGCAAGGGTGCAGG - Intronic
1046022038 8:108676675-108676697 TTCTAGTTTGAGAAGGGGGAAGG - Intronic
1046193280 8:110827508-110827530 GTGTGGTGTGGGAGGAGGGAGGG - Intergenic
1046283902 8:112070998-112071020 CTAGGGTTTGGGAAGGGTAAGGG + Intergenic
1046359630 8:113132773-113132795 CTGTGCATTGGGAATAGGGAAGG + Intronic
1046582687 8:116112527-116112549 CTGTAGTTTGGGAAAGGGAAAGG - Intergenic
1047175185 8:122534171-122534193 CGGGGTGTTGGGAAGGGGGATGG - Intergenic
1047621006 8:126608002-126608024 CTGGGGTGGGGGGAGGGGGAGGG - Intergenic
1048038892 8:130706289-130706311 ATGTGGTTTGGAAGGGGGCAGGG - Intergenic
1048182214 8:132205961-132205983 CTTTGGTATGTGAAGGTGGAAGG + Intronic
1048467607 8:134679942-134679964 TTGGGGGTTGGGGAGGGGGAGGG + Intronic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1049346940 8:142144136-142144158 CTGTGGCCAGGGAAGGGGGTGGG + Intergenic
1049616093 8:143576369-143576391 CCGGGGTTTGGGAATGGGCAGGG - Intronic
1049725522 8:144143889-144143911 CTCTGGACTGGGCAGGGGGAGGG + Intergenic
1049825863 8:144667385-144667407 CTGGAGATTGGGAAGGGGGTGGG - Intergenic
1049859614 8:144889742-144889764 AAGTGGCTTGGGCAGGGGGAGGG - Intronic
1050495625 9:6238811-6238833 CTGTGGTTTGTGGAGGGAGCAGG - Intronic
1050497324 9:6258169-6258191 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1050615958 9:7402050-7402072 GTGTGTGTTGGGAAAGGGGATGG - Intergenic
1050618563 9:7429117-7429139 CTCTGCTTGAGGAAGGGGGAGGG - Intergenic
1051235887 9:14998263-14998285 GTGGGGTGTGGGGAGGGGGAAGG + Intergenic
1051365223 9:16317019-16317041 TTGTGATTTGGGGAGGAGGAGGG + Intergenic
1051370583 9:16355671-16355693 CTGTGGCTTGGGATGGGGAGAGG - Intergenic
1051410695 9:16786854-16786876 GTGAGTTTTGGGATGGGGGAAGG - Intronic
1051585930 9:18726889-18726911 CTGGGGCTGGGGCAGGGGGAGGG - Intronic
1051684793 9:19646820-19646842 ATGTGTTTTGGGATGAGGGAAGG - Intronic
1051744064 9:20278085-20278107 GTGGGGTTGGGGGAGGGGGAGGG + Intergenic
1051813227 9:21074549-21074571 GTGTGATATGGGAAGGGGGAAGG + Intergenic
1051860530 9:21620324-21620346 CAGTTGTTTGGGAAGGAGGGAGG - Intergenic
1051976068 9:22950857-22950879 GTGGGGTTGGGGGAGGGGGAAGG - Intergenic
1052713384 9:32085403-32085425 CTGTGTGTTGGGTAGTGGGAGGG + Intergenic
1052736231 9:32345252-32345274 ATGGGGTTTGAGAAGGAGGAGGG - Intergenic
1053396278 9:37777322-37777344 CTGTGGCCTGGGATGGGGAAGGG - Intronic
1053699543 9:40675859-40675881 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1054310832 9:63475260-63475282 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1054409621 9:64799411-64799433 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1054997922 9:71413097-71413119 GTGGGGTTGGGGGAGGGGGACGG + Intronic
1055451730 9:76436957-76436979 GTGGGGTGTGGGGAGGGGGAAGG + Intronic
1055859661 9:80732901-80732923 CTGTGGGGTGGGAGGCGGGAAGG - Intergenic
1056485077 9:87047737-87047759 CTGTTGTGGGGGAGGGGGGAAGG + Intergenic
1057620378 9:96629294-96629316 CTGTAGTTGTGGAAGGGTGAAGG + Intergenic
1057641402 9:96826398-96826420 GTGGGGTTGGGGGAGGGGGAAGG + Intronic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058146648 9:101419420-101419442 CTGGGGGTTGGTAAGTGGGATGG - Intergenic
1058235816 9:102487842-102487864 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1058370351 9:104259129-104259151 CTTTGGTTTGGAAAGGGGAGGGG - Intergenic
1058747119 9:108002602-108002624 CTGTGGTCTGGCAAGGAGCAGGG + Intergenic
1059446682 9:114342502-114342524 CTGTGGTTGGGGCGGGGGGTTGG - Intronic
1059606604 9:115842086-115842108 CTTTGGATTGGGAAGGAGGACGG + Intergenic
1059629294 9:116102753-116102775 ATCTGGTTTGGGAATGGGAACGG - Intergenic
1059699406 9:116760655-116760677 TTGTGCCTGGGGAAGGGGGAGGG + Intronic
1059874910 9:118623670-118623692 CTAGGGTTGGGGATGGGGGAAGG + Intergenic
1060006357 9:120003539-120003561 CTCTGGATTAGGAAGTGGGAAGG - Intergenic
1060201511 9:121654266-121654288 GAGTGGATTGGGAAGGGGGCTGG + Intronic
1060972303 9:127745158-127745180 CTGTTCTTTGGGAAGGGGTGCGG - Intronic
1061679546 9:132236177-132236199 CTGTGGTGGGTGAAGGGAGAAGG + Intronic
1061860262 9:133464329-133464351 TGGTGGATAGGGAAGGGGGATGG + Intronic
1062291043 9:135794508-135794530 CTGCGGTTAGTGAAGGGGCAGGG - Intergenic
1062315909 9:135966953-135966975 CTGTGGTTGGGGCTGGGGTAGGG - Intergenic
1062315922 9:135966988-135967010 CTGTGGTTGGGGCTGGGGTAGGG - Intergenic
1062315971 9:135967128-135967150 CTGTGGTTGGGGCTGGGGTAGGG - Intergenic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1203442486 Un_GL000219v1:22526-22548 CTGGGGTTCGGGGAGAGGGAGGG - Intergenic
1203453035 Un_GL000219v1:138451-138473 CTGAGGTTTGGTAGGGAGGAAGG - Intergenic
1203513294 Un_KI270741v1:141435-141457 CTGGGGTTCGGGGAGAGGGAGGG - Intergenic
1185612794 X:1402447-1402469 CTGAATTTTGGGAGGGGGGAAGG - Intergenic
1185889504 X:3811603-3811625 ATGTGGTTTGAGAAGGGAGGTGG + Intergenic
1186185662 X:7017272-7017294 CTCTATTTTGGGAAGGGTGAGGG + Intergenic
1186389820 X:9147937-9147959 CTGTGGCTGGGGGTGGGGGAGGG - Intronic
1186541523 X:10405885-10405907 CTGGGGTCGGGGAAGGGGGGAGG + Intergenic
1186647254 X:11520303-11520325 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1186936657 X:14458015-14458037 TTGTGGGGTGGGGAGGGGGAGGG - Intergenic
1187002461 X:15196719-15196741 GTGGGGTTGGGGGAGGGGGAAGG - Intergenic
1187470715 X:19567097-19567119 CAGAGGTTAGGGAAGGGGGTGGG + Intronic
1187769883 X:22683146-22683168 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
1188306715 X:28568150-28568172 CTGTGGTTTGTGAAGGTATATGG - Intergenic
1188448302 X:30281181-30281203 ATGAGGTTGGGGAGGGGGGAGGG - Intergenic
1188712786 X:33422294-33422316 GTGGGGTTGGGGGAGGGGGAGGG - Intergenic
1188938282 X:36204428-36204450 GTGGGGTTGGGGGAGGGGGAGGG + Intergenic
1189156045 X:38757643-38757665 TTGTGCTTAGGGAAGGGTGAAGG - Intergenic
1189538908 X:41965947-41965969 CTTTGGTTTGGGATGGTGAAAGG + Intergenic
1190057262 X:47188222-47188244 CTCTGGGGTGGGAAGAGGGAAGG - Intergenic
1190737325 X:53264335-53264357 TTGTGCTGTGGGAAGGGGGTGGG - Intronic
1190970434 X:55342707-55342729 CTGTGTGTTGGGACGGGGGTAGG - Intergenic
1191018205 X:55833079-55833101 TTGGGGTTGGGGAAGGGGGGAGG + Intergenic
1191075944 X:56453265-56453287 GTGTGGTTGGGGGAGGGGGGAGG + Intergenic
1191569322 X:62589019-62589041 CTGGGGTGGGGAAAGGGGGAAGG - Intergenic
1191932373 X:66388305-66388327 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1191999716 X:67136456-67136478 GTGGGGTGTGGGAAGGGGGAGGG - Intergenic
1192013238 X:67298817-67298839 GTGGGGTTGGGGATGGGGGAGGG - Intergenic
1192229372 X:69254617-69254639 CTGGGGGTGGGGAAGGGAGAAGG + Intergenic
1192265153 X:69532562-69532584 CTGTGGCTTGGGGAGGGGGTGGG + Intergenic
1192432991 X:71125235-71125257 ATGTGGGTTGGGAAAGGGAAGGG + Intronic
1192437571 X:71152406-71152428 CTGGGGTGGGGGAAAGGGGAAGG - Intronic
1192525325 X:71838073-71838095 TTGTGGGGTGGGAGGGGGGAGGG - Intergenic
1192729989 X:73793484-73793506 CTGTGATATGGAAAGGGGAAGGG - Intergenic
1192760824 X:74094757-74094779 GTGGGGTGTGGGAGGGGGGAGGG - Intergenic
1192795386 X:74421255-74421277 CAGTAGTTTGGGAAGGGAGCTGG + Intergenic
1192906931 X:75561412-75561434 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1193320511 X:80115602-80115624 ATGTGATTTGGGAAGGGCCAAGG + Intergenic
1193664645 X:84300490-84300512 CTGTGCCTTTGGAAAGGGGAGGG + Intergenic
1193755979 X:85408950-85408972 CAGTGGACTGGGTAGGGGGAGGG - Intergenic
1194042009 X:88952558-88952580 ATGAGGTTGGGGAGGGGGGAGGG + Intergenic
1194257034 X:91646855-91646877 GTGGGATTTGGGAGGGGGGAGGG + Intergenic
1194337227 X:92663052-92663074 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1194454506 X:94085660-94085682 GTGGGGTTGGGGGAGGGGGAGGG - Intergenic
1194517112 X:94868237-94868259 GTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1194558549 X:95393105-95393127 CTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1194659041 X:96608359-96608381 CTGTGGCTTGGCATGGGGCAAGG - Intergenic
1194683001 X:96876759-96876781 GTGGGGTTTGGGGAGGGGGGAGG + Intronic
1195270176 X:103221030-103221052 TGGTGGTTGGGGAAGGGGGCGGG - Intergenic
1195421968 X:104685619-104685641 CTGGGGTGGGGGAAGGGGGAAGG + Intronic
1195688299 X:107604266-107604288 CTGTGGATCGGGGAGGGGGGTGG + Exonic
1195962599 X:110401572-110401594 CTGTGTTGTGGTAAGGGGAAGGG + Intronic
1196002652 X:110803360-110803382 GTGGGGTTGGGGAAGGGGGGAGG - Intergenic
1196428928 X:115601482-115601504 GTGGGGTTGGGGGAGGGGGAAGG + Intronic
1196484169 X:116184784-116184806 GTGGGGTTGGGGGAGGGGGAGGG + Intergenic
1196562965 X:117173021-117173043 TTGTGCTTTGTGCAGGGGGAAGG + Intergenic
1196632100 X:117953403-117953425 GTGGGGTGGGGGAAGGGGGAAGG + Intronic
1196720755 X:118851560-118851582 GTGGGGTGTGGGGAGGGGGAGGG - Intergenic
1197059511 X:122160719-122160741 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1197346317 X:125327926-125327948 CTGTGGTTGAGGAAGGGGGCAGG - Intergenic
1197395922 X:125927511-125927533 TTGTGGGGTGGGACGGGGGAGGG - Intergenic
1197845818 X:130801260-130801282 TTATGGTGGGGGAAGGGGGAAGG + Intronic
1198065865 X:133096138-133096160 CAGTGCTTTGGGAGGTGGGAAGG - Intronic
1198178120 X:134175047-134175069 CTGTGGTCTGGGGGAGGGGACGG - Intergenic
1198254617 X:134914530-134914552 CAGAGGTCTGGGGAGGGGGAAGG + Intronic
1198307296 X:135395804-135395826 CTGAGCTTTGGGAGGGGGGTAGG + Intergenic
1199422468 X:147659602-147659624 GTGGGGTTGGGGGAGGGGGAAGG + Intergenic
1200102866 X:153696721-153696743 CTGGGGACTGGGAAGGGGGCAGG + Intergenic
1200267872 X:154655501-154655523 CTGGGGACTGGGAAGGGGGCAGG + Intergenic
1200397671 X:156000723-156000745 CTGTGGTCAAGGATGGGGGAAGG + Intronic
1200786248 Y:7263357-7263379 CTTTGGTTTAGGAAGGCGGTGGG - Intergenic
1200824698 Y:7625827-7625849 CTTTGGTTTAGGAAGGGGAGGGG - Intergenic
1200825123 Y:7629758-7629780 CCTTGGTTTAGGAAGGGGAAGGG + Intergenic
1201403017 Y:13623505-13623527 GTGTGGCTGGGGAAGGGGGGAGG - Intergenic
1201413999 Y:13729636-13729658 CTGGGGGATGGGCAGGGGGAAGG - Intergenic
1201721065 Y:17097926-17097948 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic
1202055005 Y:20820527-20820549 GTGGGGTTGGGGGAGGGGGAAGG - Intergenic
1202074100 Y:21021223-21021245 CTTTGGTTTAGGAAGGGGAGGGG + Intergenic
1202078800 Y:21063078-21063100 CTTTGGTTTAGGAAGGGGAGGGG + Intergenic
1202234932 Y:22701328-22701350 CCTTGGTTTAGGAAGGGGAAGGG - Intergenic
1202235357 Y:22705260-22705282 CTTTGGTTTAGGAAGGGGAGGGG + Intergenic
1202307802 Y:23490908-23490930 CTTTGGTTTAGGAAGGGGAGGGG - Intergenic
1202308227 Y:23494840-23494862 CCTTGGTTTAGGAAGGGGAAGGG + Intergenic
1202562574 Y:26175746-26175768 CCTTGGTTTAGGAAGGGGAAGGG - Intergenic
1202562999 Y:26179678-26179700 CTTTGGTTTAGGAAGGGGAGGGG + Intergenic