ID: 1008609896

View in Genome Browser
Species Human (GRCh38)
Location 6:53176099-53176121
Sequence TGCAAAAGGCTAACCAGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008609896_1008609901 15 Left 1008609896 6:53176099-53176121 CCGGCCCTGGTTAGCCTTTTGCA No data
Right 1008609901 6:53176137-53176159 TAGAATGGTGCCTATCCCCAAGG No data
1008609896_1008609900 0 Left 1008609896 6:53176099-53176121 CCGGCCCTGGTTAGCCTTTTGCA No data
Right 1008609900 6:53176122-53176144 TATGTTACATTTTTTTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008609896 Original CRISPR TGCAAAAGGCTAACCAGGGC CGG (reversed) Intergenic
No off target data available for this crispr