ID: 1008617071

View in Genome Browser
Species Human (GRCh38)
Location 6:53237007-53237029
Sequence TTGGGTTTACTGTAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008617071_1008617077 22 Left 1008617071 6:53237007-53237029 CCTCCCTCCTACAGTAAACCCAA No data
Right 1008617077 6:53237052-53237074 TATTTCTACAATAGCTCTCACGG No data
1008617071_1008617078 30 Left 1008617071 6:53237007-53237029 CCTCCCTCCTACAGTAAACCCAA No data
Right 1008617078 6:53237060-53237082 CAATAGCTCTCACGGCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008617071 Original CRISPR TTGGGTTTACTGTAGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr