ID: 1008617076

View in Genome Browser
Species Human (GRCh38)
Location 6:53237026-53237048
Sequence TCAAGCTGATCAGATTTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008617076_1008617079 30 Left 1008617076 6:53237026-53237048 CCAAATAAATCTGATCAGCTTGA No data
Right 1008617079 6:53237079-53237101 CAGGATTTAGTCTGATCTCCTGG No data
1008617076_1008617078 11 Left 1008617076 6:53237026-53237048 CCAAATAAATCTGATCAGCTTGA No data
Right 1008617078 6:53237060-53237082 CAATAGCTCTCACGGCTATCAGG No data
1008617076_1008617077 3 Left 1008617076 6:53237026-53237048 CCAAATAAATCTGATCAGCTTGA No data
Right 1008617077 6:53237052-53237074 TATTTCTACAATAGCTCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008617076 Original CRISPR TCAAGCTGATCAGATTTATT TGG (reversed) Intergenic
No off target data available for this crispr