ID: 1008617078

View in Genome Browser
Species Human (GRCh38)
Location 6:53237060-53237082
Sequence CAATAGCTCTCACGGCTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008617076_1008617078 11 Left 1008617076 6:53237026-53237048 CCAAATAAATCTGATCAGCTTGA No data
Right 1008617078 6:53237060-53237082 CAATAGCTCTCACGGCTATCAGG No data
1008617075_1008617078 12 Left 1008617075 6:53237025-53237047 CCCAAATAAATCTGATCAGCTTG No data
Right 1008617078 6:53237060-53237082 CAATAGCTCTCACGGCTATCAGG No data
1008617074_1008617078 23 Left 1008617074 6:53237014-53237036 CCTACAGTAAACCCAAATAAATC No data
Right 1008617078 6:53237060-53237082 CAATAGCTCTCACGGCTATCAGG No data
1008617071_1008617078 30 Left 1008617071 6:53237007-53237029 CCTCCCTCCTACAGTAAACCCAA No data
Right 1008617078 6:53237060-53237082 CAATAGCTCTCACGGCTATCAGG No data
1008617072_1008617078 27 Left 1008617072 6:53237010-53237032 CCCTCCTACAGTAAACCCAAATA No data
Right 1008617078 6:53237060-53237082 CAATAGCTCTCACGGCTATCAGG No data
1008617073_1008617078 26 Left 1008617073 6:53237011-53237033 CCTCCTACAGTAAACCCAAATAA No data
Right 1008617078 6:53237060-53237082 CAATAGCTCTCACGGCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008617078 Original CRISPR CAATAGCTCTCACGGCTATC AGG Intergenic
No off target data available for this crispr