ID: 1008617467

View in Genome Browser
Species Human (GRCh38)
Location 6:53240462-53240484
Sequence GGCAACAAGAAACCCCAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008617461_1008617467 18 Left 1008617461 6:53240421-53240443 CCCAAGGTATCTTGCTATTTTTC No data
Right 1008617467 6:53240462-53240484 GGCAACAAGAAACCCCAAGTGGG No data
1008617462_1008617467 17 Left 1008617462 6:53240422-53240444 CCAAGGTATCTTGCTATTTTTCA No data
Right 1008617467 6:53240462-53240484 GGCAACAAGAAACCCCAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008617467 Original CRISPR GGCAACAAGAAACCCCAAGT GGG Intergenic
No off target data available for this crispr