ID: 1008621385

View in Genome Browser
Species Human (GRCh38)
Location 6:53274788-53274810
Sequence TTCTTTCTGGTCCTTCTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 365}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008621385 Original CRISPR TTCTTTCTGGTCCTTCTGTA TGG (reversed) Intronic
900804659 1:4759575-4759597 TTCTTTGAGGACCTTCTGTACGG + Intronic
901475545 1:9486818-9486840 TTCTTTCGGGTCTTTCCGTATGG - Intergenic
902769692 1:18638383-18638405 TTCTTCCTGGTTCTGCTGCAGGG - Intronic
903381077 1:22897186-22897208 TTCTCTCTGGCCCTTCAGGAGGG - Intronic
903566710 1:24272927-24272949 TTCTTTCAGGAGCTCCTGTAAGG + Intergenic
903754389 1:25650803-25650825 TCCTTTATTCTCCTTCTGTAAGG - Intronic
904247138 1:29195811-29195833 TTCTCTTTGATCCTTCTGTGGGG + Intronic
904821919 1:33251098-33251120 TTCTTTCTGTCCCTTCAGTGTGG - Intergenic
905146054 1:35887521-35887543 TGCTGTCTGGACCTTCTGTGTGG + Intronic
905724471 1:40238533-40238555 TTCCTTCTTGTTCTTCTCTATGG - Exonic
906683463 1:47747171-47747193 TTCTTTCTGGTCCATATGAGTGG - Intergenic
906783611 1:48594876-48594898 TTCTCTCTTGCCCTTCTGCATGG + Intronic
908705010 1:66943729-66943751 TATTTTCTGGTGCTTCTGAAAGG + Intronic
908791680 1:67788929-67788951 TTCTTTTTCGTAGTTCTGTATGG - Intronic
909806439 1:79878132-79878154 TCCTTTCAGGACCTCCTGTAAGG - Intergenic
909829110 1:80163047-80163069 TTCTTTCCTTTCATTCTGTAGGG - Intergenic
910296812 1:85655284-85655306 TTCTTTCTTTTCCTTTTGCAGGG - Intronic
910422476 1:87081153-87081175 TTCTTTGTGGTTTTTCTGTCTGG - Intronic
911341118 1:96639195-96639217 TTCATTTTAGTCCTTCTGTTAGG - Intergenic
911455434 1:98116612-98116634 CTATTTCTGATCCTTCTGTAGGG - Intergenic
912080091 1:105925498-105925520 TTCTTTCTGTTCCTACTGCTTGG + Intergenic
913553864 1:119944222-119944244 TTCTTTATGTTTCTTCTGTTTGG - Intronic
914916797 1:151824060-151824082 TTGTTTCTGCTCCTTTTGTCGGG + Intronic
915044930 1:153004415-153004437 CTCTTGCTGGTCCATCTTTAGGG - Intergenic
915148702 1:153811617-153811639 TACTTTCTGTTCTTTCTTTAGGG - Intronic
917950721 1:180031473-180031495 ATCTTTCTGGACATTCTGTGAGG + Exonic
919840630 1:201606545-201606567 GTCTTTCTAGTCCTTCTGTTTGG - Intergenic
919935712 1:202249280-202249302 TTCTTCCTGTGCCTTCTGTAAGG + Intronic
920546169 1:206820476-206820498 ATCTTTCTGGCCCTTATGTTTGG - Intronic
921681223 1:218034543-218034565 TTCTTTCTGCTTCTTGGGTATGG - Intergenic
922476500 1:225910422-225910444 TTCTTTCTGGTCTATCTCTTTGG + Intronic
923285203 1:232487760-232487782 TTCCTTCTGTTCCTTCAGTTTGG - Intronic
923369516 1:233296038-233296060 TTCTCTCTGATCCTCCTGTTAGG + Intergenic
924067474 1:240239690-240239712 TTCTTTCTGGCCCTTTTATAGGG - Intronic
924382490 1:243477231-243477253 TTCCTGCTGGTGCTTCTGTATGG + Intronic
924670712 1:246122033-246122055 TTCTTCCTGTTCATTCTGCAAGG - Intronic
1063067169 10:2622034-2622056 TTCTTAGTGTTCCTTCTGAAAGG - Intergenic
1063549748 10:7019509-7019531 TTCTTTTTGGTTCTTTTTTATGG - Intergenic
1064452343 10:15453864-15453886 GTGTTTCTGGTCCTTATGAACGG - Intergenic
1065564970 10:26999043-26999065 TTGTTTCTTGGCCTCCTGTAAGG + Intronic
1067647416 10:48121771-48121793 TTAATTCTTGTGCTTCTGTAGGG - Intergenic
1068042478 10:51842480-51842502 TTCCTTCTGATCCTTATGTGTGG + Intronic
1068187577 10:53605858-53605880 TTCTTTCTCTTCCTCCTGAAGGG + Intergenic
1070095638 10:73335569-73335591 TTCATTCTGCTCCATCTATAGGG + Intronic
1071227003 10:83542351-83542373 TCCTTTGTGGTCCTGCTGCAAGG + Intergenic
1072366608 10:94717346-94717368 TTCCTTCTGGTGCTCTTGTAGGG + Intronic
1072746923 10:97946799-97946821 TTCTTTCTGGGGCTTCTGGAGGG - Intronic
1073029275 10:100512112-100512134 CTCTTTGGGGGCCTTCTGTAAGG - Intronic
1073063346 10:100744982-100745004 CTCTTTCTGGTCCTTCCCTTTGG - Intronic
1073282407 10:102364152-102364174 TTCATTCTGGTGCTTTAGTAAGG + Intronic
1074483429 10:113850034-113850056 CTCATCCTGGTCCTTCAGTAAGG + Exonic
1075300021 10:121314053-121314075 TGCTTTGTGGTCCTTTTGGAAGG - Intergenic
1076278410 10:129224994-129225016 TTCTTTCAGGTCCCTCTGGAAGG - Intergenic
1077829150 11:5845244-5845266 TTGTTTCTGAACCTTATGTACGG - Intronic
1077871757 11:6268821-6268843 TTCTGTAAGGCCCTTCTGTAAGG - Intronic
1078119160 11:8488835-8488857 TACTTTGTTTTCCTTCTGTATGG - Intronic
1078321797 11:10341589-10341611 TTCTTTCAGGACCTCTTGTAAGG - Intronic
1078391517 11:10939057-10939079 TTCTTTTTCTTCCTTCTGTAGGG + Intergenic
1080486283 11:32710733-32710755 TTCTTTGTTGACCTTCTGTCTGG + Intronic
1080674118 11:34408929-34408951 TACTTTCTGTTTCTTCTTTAGGG + Intergenic
1081210543 11:40328536-40328558 CTCTTTCTGGGACTTCTCTAAGG + Intronic
1082053845 11:47796449-47796471 TTTTTGCTGGTCCTTCTGGGAGG - Intronic
1082319584 11:50784668-50784690 TTCTTTCTAGTTCTTATGTGAGG + Intergenic
1083123480 11:60538909-60538931 TTCTTTCTGGTCCTTGCATGTGG - Intronic
1083668259 11:64286657-64286679 CTCTGGCTGGTGCTTCTGTATGG + Exonic
1084644286 11:70445693-70445715 TTGTTTCTGGGTCTTCTTTAGGG - Intergenic
1086748766 11:90463577-90463599 TTATCTCTGCCCCTTCTGTAAGG + Intergenic
1086858865 11:91900591-91900613 TTCTTTCTCGTCCTTTTTTTTGG - Intergenic
1087280975 11:96209797-96209819 TTCTTTCTTTTCCTGCTGGAGGG - Intronic
1087867272 11:103246249-103246271 CAGTTTCTGGTCCTTCTGTTGGG + Intronic
1088314006 11:108488833-108488855 TTCTCTCTGGTCATTTTGGATGG - Intronic
1090469850 11:126970509-126970531 TTTTTTCTGGACCCTCTGTGGGG - Intronic
1090773864 11:129946401-129946423 TTTCTCCTGGTCCTTCTGTGTGG - Intronic
1092964530 12:13628704-13628726 TTCTTTCTGATACTTCTGTATGG - Intronic
1093248757 12:16773207-16773229 TTCTTTCAGGAGCTCCTGTAAGG + Intergenic
1093992158 12:25602262-25602284 TTCTTTCTTTTCTTTCTTTAGGG + Intronic
1095069927 12:37829164-37829186 TTCTTTCTGGTTTTTATGTGAGG - Intergenic
1095079983 12:37988225-37988247 TTCTTTCTGGTTTTTATCTAGGG - Intergenic
1095082590 12:38023734-38023756 TTCTTTCTGATTTTTATGTAGGG - Intergenic
1095994539 12:48069240-48069262 TACATTCTGATCCTTCTGTCTGG - Intronic
1096686285 12:53290381-53290403 CTCTTTCTGTGCCTTCTGGATGG - Exonic
1098670679 12:73226078-73226100 TTGTTTCTGGTGTATCTGTAAGG - Intergenic
1098789356 12:74801922-74801944 TTTATTCTGGGCCTTCTGAATGG + Intergenic
1098885212 12:75953927-75953949 TTATTTCTTGTCCTTCTTCATGG - Intergenic
1099464933 12:82972822-82972844 TTCTTTCTCAGCCTTCTGTGTGG + Intronic
1100857830 12:98773834-98773856 TGCTTTCTGCTAATTCTGTATGG + Intronic
1101784268 12:107869049-107869071 TTCTTTATTGACCTTCTGTCTGG - Intergenic
1103178494 12:118886526-118886548 ATCTCCCTGGTCCTTCTGTCAGG + Intergenic
1103287921 12:119818290-119818312 TTTTTTCTAGTCCTTTAGTATGG - Intronic
1104878418 12:132052803-132052825 CTCTGTCTGTTCCTTCTGTGAGG - Intronic
1107203120 13:37746603-37746625 TTTTGTCTGGTCTTTTTGTAGGG - Intronic
1109182371 13:59229266-59229288 TTCTTTCTCGACACTCTGTAGGG - Intergenic
1110021091 13:70474292-70474314 TTCTTTGTGGTGCTTTAGTAAGG + Intergenic
1110422907 13:75333793-75333815 TTCTTTAGGGTCCTTCAGTCTGG + Intronic
1110784062 13:79502523-79502545 TTCATTCTGTTTCTTTTGTAAGG - Intronic
1110831600 13:80037981-80038003 GACTTTCCGTTCCTTCTGTAAGG + Intergenic
1110840574 13:80137423-80137445 TTCTTTCTGGTCCATGATTATGG + Intergenic
1111656061 13:91155217-91155239 TTCTTGCTGCTGCTTCTGTTGGG - Intergenic
1113995630 14:16065675-16065697 TTCTGTCTAGTCTTTCTGTGAGG - Intergenic
1117365178 14:55020107-55020129 TTCTTTCTGGTCATTCTTCTGGG + Intronic
1117466563 14:56000246-56000268 TTCTTGCTTGTCCGTCTGTCAGG - Intergenic
1117477300 14:56109271-56109293 TACTTGCTGTGCCTTCTGTATGG + Intergenic
1117825202 14:59694828-59694850 TTCTTTCTGTGGCTTCTCTAGGG - Intronic
1118143873 14:63115142-63115164 CTCTTTCTGGTCCTTGTAAATGG - Intergenic
1118757798 14:68857845-68857867 TTCTTTCTGGCCTCTCTGTGAGG - Intergenic
1119089013 14:71763103-71763125 TTATTTCTGCTGCTTCTGTTTGG + Intergenic
1119583119 14:75805533-75805555 TTCATCCTGGTACTTCTCTATGG + Intronic
1119833942 14:77730075-77730097 TACTTGCTGGCCCTTCTGTGTGG + Intronic
1119937467 14:78605378-78605400 TTCTTTCTCCTCCTTTTATAGGG - Intronic
1121139971 14:91532886-91532908 TTTTGTCTGATTCTTCTGTAAGG - Intergenic
1125331701 15:38589009-38589031 TTCTTTCTTACCCTTCTGGATGG - Intergenic
1125760194 15:42091096-42091118 TTCTCTCGTGTCTTTCTGTAGGG + Intronic
1126343282 15:47667092-47667114 TGGTTTCTGGTGCTTCAGTAGGG - Intronic
1126888572 15:53179199-53179221 TTTTTTCTGTTCCCTCTGTGAGG + Intergenic
1127158240 15:56151536-56151558 TTCTTTCAGGACCTCTTGTAAGG - Intronic
1130367287 15:83252032-83252054 TTCTTTCTCTTCCTTCTCTAAGG - Intergenic
1130786739 15:87105505-87105527 TTCTGTTTGGTTCTTCTTTATGG - Intergenic
1132732890 16:1371547-1371569 CTCTTCCAGGTCCTTCTCTAGGG + Intronic
1133146447 16:3790673-3790695 CTCGTTGTGGTTCTTCTGTAGGG + Intronic
1133525760 16:6603795-6603817 TTATTTCTCGTCCTGCTGTTTGG + Intronic
1134241217 16:12508433-12508455 TTTTTTCTGTTGCTTCTGGATGG + Intronic
1135054090 16:19216181-19216203 CTCATTCTGTTCCATCTGTATGG + Intronic
1136744321 16:32570844-32570866 TTCTTTCTGGTTTTTATCTATGG - Intergenic
1136996737 16:35195781-35195803 TTCCTTCTGGTCTTCCTGCACGG - Intergenic
1138876445 16:60956681-60956703 ATCTTACTGGTCCCTCTGTATGG + Intergenic
1139151845 16:64391182-64391204 TTCTTTCAGGTGCTTCTTCAGGG + Intergenic
1141182395 16:81763152-81763174 TTCCTTCTTTGCCTTCTGTAAGG - Intronic
1141238519 16:82242969-82242991 TTCTTTCTGGTGTTTCTCTTTGG - Intergenic
1141941728 16:87280673-87280695 GTCTTTCTGGTCTTTCTCTCAGG + Intronic
1203025278 16_KI270728v1_random:504388-504410 TTCTTTCTGGTTTTTATCTATGG + Intergenic
1203046443 16_KI270728v1_random:830043-830065 TTCTTTCTGGTTTTTATCTATGG - Intergenic
1143469363 17:7162175-7162197 TTTTTTCTTGTCATTGTGTAGGG + Intergenic
1143794743 17:9327568-9327590 TTCTTCCTGGTCTCTCTGTGTGG + Intronic
1145194451 17:20877240-20877262 TTCTTTCTGGTTTGTCTGTAAGG - Intronic
1145297584 17:21603816-21603838 TTCTTTCTGGTTTGTCTGTAAGG + Intergenic
1145352670 17:22099587-22099609 TTCTTTCTGGTTTGTCTGTAAGG - Intergenic
1146250679 17:31340929-31340951 TTGTTTATGCTCATTCTGTAAGG - Intronic
1147323351 17:39658891-39658913 TTCTTTCTATTCCTTCTATCAGG + Intronic
1147329242 17:39687097-39687119 TTCTCTCTGTTCCCTCTGTCTGG + Intronic
1147913548 17:43872726-43872748 TTCTTTCTGTTTTTTCTGTTTGG + Intergenic
1149602705 17:57903592-57903614 TTCTCTGTGGACCTGCTGTATGG - Intronic
1150667112 17:67151122-67151144 TTCTTTCTGGGGCATCTGAAAGG + Exonic
1152592627 17:81221373-81221395 GTCTTTCTGATCTTTCTGAACGG + Intronic
1152703523 17:81831629-81831651 ATCTTTCTGGTCCAGCTGTGGGG - Intronic
1153046844 18:863843-863865 TACTTTCTGGTCTTTCTCTGTGG + Intergenic
1153148521 18:2061155-2061177 TACTTGCTGATCCTTCTGTTTGG - Intergenic
1153837715 18:8978982-8979004 TTCTGTCTGCGCCTTCTATAGGG - Intergenic
1155310577 18:24518889-24518911 TTCTTTCTCCACCTTCTTTAAGG + Intergenic
1155672645 18:28390011-28390033 TTCTTTCAGGAGCTCCTGTAAGG - Intergenic
1155742753 18:29310714-29310736 TTCTTTCTTGTCCTGCTGTTTGG + Intergenic
1157434440 18:47656556-47656578 TTCATGCTGCTCCTTCTGTCTGG - Intergenic
1157998569 18:52588693-52588715 TTCTGTCTGCTCCCTCTTTATGG - Intronic
1158011691 18:52735815-52735837 TTGTTCCTGGTTCATCTGTAAGG - Intronic
1158899775 18:61951814-61951836 TGCTTACTGTTTCTTCTGTATGG + Intergenic
1159630646 18:70745825-70745847 TTCTTTATTATCCTTCTGCAGGG - Intergenic
1160008305 18:75084745-75084767 TTCTTTCTGCTCGTTTTGTGAGG - Intergenic
1164152182 19:22564518-22564540 TTCCTTCAGGGCCTCCTGTAAGG + Intergenic
1165185129 19:34012915-34012937 TTCTTACTGGTTCTTTTCTATGG - Intergenic
1165707353 19:37986036-37986058 TGCTTTCTGGAGCTTCTCTAGGG - Intronic
1165760657 19:38319631-38319653 TTCCTTCTCGTCCTCCTGGAAGG - Intergenic
1166955185 19:46459466-46459488 TTCTGTCTGGAGCTTATGTAAGG + Intergenic
1167068516 19:47205343-47205365 TTTTTTCTGATCCTTCTCTCTGG + Intronic
925077054 2:1025539-1025561 TTCTTTCTGGAAATTCTGGAGGG + Intronic
925475413 2:4208249-4208271 TTCTTCCTCTTCCCTCTGTATGG + Intergenic
925532162 2:4876121-4876143 TTTTTTCTTTTCTTTCTGTAAGG - Intergenic
925716817 2:6791716-6791738 TTCTCTCTGGTCCCTTTCTAGGG - Intergenic
926374227 2:12210523-12210545 TTCTTTCTGTTCCAGCTCTAAGG + Intergenic
926570148 2:14520606-14520628 TTCTTTCTTCTCTTTCTGTCTGG + Intergenic
926975379 2:18511709-18511731 TTATTTCTGGGCCTTCTTCAAGG + Intergenic
927397347 2:22668554-22668576 TTGTTTCTGGTGGTTCAGTAAGG + Intergenic
928414251 2:31078650-31078672 CTGATTCTGGTACTTCTGTAGGG - Intronic
929612429 2:43281275-43281297 TTCTTTCTAGTTGTTCTGTAAGG + Intronic
931688354 2:64814153-64814175 TCCTTCCTGCTCCTTCTCTAGGG - Intergenic
933016742 2:77137451-77137473 TTCCTTCAGGTGCTCCTGTAGGG - Intronic
934212460 2:89994498-89994520 TTCTTACTGGTTCTTTTCTAAGG + Intergenic
935050934 2:99524508-99524530 TTCTCTCTGGTCCTTGAGTGTGG - Intergenic
936786936 2:116104814-116104836 CTCTTTCTGAAACTTCTGTATGG + Intergenic
938809832 2:134842943-134842965 TACTTTCTTGTAATTCTGTAAGG - Intronic
940028067 2:149229622-149229644 TTCTTACTATTCCTTCTGCATGG + Intergenic
940277023 2:151950101-151950123 TTCTTTCCAGTCCTTCTCTTGGG - Intronic
940307199 2:152239373-152239395 TTATTTTTGTTCCTTCTGGAGGG + Intergenic
940392550 2:153149504-153149526 TTCTTACTTCTCCTTCTGTTGGG + Intergenic
940537636 2:154966763-154966785 TTCTTGCTGGTCCTTCTGCCTGG - Intergenic
941577352 2:167249755-167249777 ATCTTCCTGGTTCTTCTGTATGG - Exonic
943636938 2:190317364-190317386 TTCCTACTGTTCCTTATGTAGGG - Intronic
944192502 2:197018420-197018442 TACTTTCTGCTCCCTCTGTCTGG + Intronic
944922752 2:204432588-204432610 TTCTTTCTGCTCATTCTACAAGG - Intergenic
944971450 2:204997409-204997431 TTCTTTATTGCCCTTCAGTAAGG + Intronic
945776510 2:214112986-214113008 TTCTTTCTGGAGCTCTTGTAAGG + Intronic
946254412 2:218432505-218432527 TCCTTTCTGCTCCTTCTTCAGGG - Intronic
946761238 2:222995221-222995243 TTCTTTAGGGTTCTTCTGTTTGG + Intergenic
947053814 2:226077548-226077570 TTCTTTCTACTCCTTCTGATAGG - Intergenic
947638741 2:231694166-231694188 TTCTTACTCATCCTTCAGTAAGG + Intergenic
947837981 2:233188991-233189013 TTTTATTTGGCCCTTCTGTATGG + Intronic
948583274 2:239002715-239002737 TTCTTTCTGTTCCCTCTCTGGGG + Intergenic
1169579796 20:7007719-7007741 TTCTTCCTTTTCCATCTGTATGG + Intergenic
1170120143 20:12902520-12902542 TTCTTTCTTTTTCTTCTCTAAGG - Intergenic
1171558704 20:26100681-26100703 TTATTTCTGGAACTTCTGTTTGG - Intergenic
1171562985 20:26144893-26144915 TTCTTTCTGGTTTGGCTGTAAGG - Intergenic
1171909331 20:30928935-30928957 TTCTGTCTGGTTTTTCTGTGAGG - Intergenic
1172288991 20:33761769-33761791 TTCTTTCTGGGCCTTCCTTGTGG + Intronic
1173104525 20:40121002-40121024 TTCCTTCTGATCCTTCTGCCAGG - Intergenic
1174761630 20:53212422-53212444 TTCTTTCTTGTAATTCTTTACGG + Intronic
1174889303 20:54373537-54373559 TTCTATTTGGTCCTTTTTTATGG + Intergenic
1177465458 21:21473459-21473481 TAATTTCTGGGCCTTCTGTGAGG + Intronic
1177781221 21:25624430-25624452 TTTTTTCTGCTTTTTCTGTATGG - Intergenic
1178620270 21:34167992-34168014 TTATTTCTGGGCTTTCTGTTTGG + Intergenic
1178779077 21:35582254-35582276 TTCTTTTTGGTACTTCTGTGGGG + Intronic
1179100470 21:38351643-38351665 TTCTTTCTTTTCCCTCAGTATGG - Intergenic
1179768454 21:43593849-43593871 TTCTTTCTGTTCTTTCTTTGTGG - Intronic
1180311430 22:11241471-11241493 TTCTGTCTAGTCTTTCTGTGAGG + Intergenic
1183010702 22:34944347-34944369 TTCTTTCTGGTATTTCAGCAGGG - Intergenic
1184609469 22:45593567-45593589 TTCTTTCTGGGGCTTCGGAAAGG + Intronic
950865414 3:16184657-16184679 TTCTTTCAGGATCTTCTTTAGGG - Intronic
951262844 3:20532224-20532246 TTCTTTCTGATCTTTGAGTAGGG + Intergenic
951919660 3:27840571-27840593 CACTTTCTGGTCCTTCTATCTGG - Intergenic
952756081 3:36868857-36868879 ATCTTTCTGGTCCTCCAGTGGGG - Intronic
953338116 3:42111140-42111162 CTCCTTCTGGACCTTCTGTCTGG - Intronic
953787329 3:45921104-45921126 CTCTTTCTGGCCCTTTTGTCTGG - Exonic
954191033 3:48961155-48961177 TGTTTTCTGGTGTTTCTGTAGGG + Intronic
954438588 3:50509193-50509215 TTGTTTCTCCTCCTTCTCTAAGG - Intergenic
957722981 3:84028849-84028871 CTCTTTCTGGTCCTTAGGTGTGG + Intergenic
957947950 3:87088925-87088947 CTCTGCCTGGTCCTTCTGTAGGG - Intergenic
958207487 3:90421536-90421558 TTCTTTCTAGTTCTTATGTAAGG + Intergenic
958480646 3:94642283-94642305 TTCTTTCTGATCCTTGTATTTGG + Intergenic
959195668 3:103178051-103178073 TACCTTGTGGTCTTTCTGTAGGG - Intergenic
960163278 3:114373498-114373520 TTCTTTCTATTCCTTCTGCCTGG + Intronic
962188350 3:133284120-133284142 GTCTTTCTCATCCTTCTGTTTGG + Intronic
962655368 3:137538751-137538773 TTCTTTCTGGTTCTTTTTTTGGG + Intergenic
962940815 3:140123243-140123265 TTCATTCTAGTCCTTTTATAAGG + Intronic
963094637 3:141523060-141523082 TTCTCTCTGCTTCTTATGTATGG + Intronic
963160385 3:142144893-142144915 CTGTCTCTGGTCCTTATGTATGG - Intronic
965220501 3:165920932-165920954 TACTTTCTGTTCCTTCTGCCTGG - Intergenic
966463857 3:180206881-180206903 TTCTTTCTTTTCTTTCTGTAAGG - Intergenic
967327496 3:188256469-188256491 TTCTTAATGGTCATTCTGTTTGG - Intronic
967381945 3:188868743-188868765 TTGTTTGTGGTCCTTTTGAATGG + Intronic
970424545 4:15934109-15934131 TTCTGACTGGTCCCTCTGTTTGG + Intergenic
971191325 4:24431586-24431608 GTCTTTCTGGTTCTTCTCTCTGG - Intergenic
971821017 4:31555448-31555470 TTCTTTCTGTTCCTTATATGTGG + Intergenic
971988545 4:33861061-33861083 TTCTTTCTGGTTTGTCTGTAAGG + Intergenic
972238075 4:37157478-37157500 TTCTTTCTGGTGTGTCTGTGAGG + Intergenic
972265631 4:37456070-37456092 TTCTTTTTGGTCATTCTTTTTGG + Intronic
973135742 4:46704327-46704349 TTCTTTATTGTCCTTTTATAAGG - Intergenic
973240464 4:47950925-47950947 TTCTCTCTGATCCTTCTTTCAGG - Intronic
973246788 4:48017657-48017679 TTTTATCGGGGCCTTCTGTATGG - Intronic
973412726 4:49847936-49847958 TTCTTTCTGGTTTTTATGAAAGG - Intergenic
974394519 4:61317536-61317558 TTCTTTCTCCTTCTTGTGTAAGG + Intronic
974472809 4:62339996-62340018 ATATTCCTGCTCCTTCTGTAAGG - Intergenic
974513655 4:62878693-62878715 TTCCTTCTGGATCTTCTGAAGGG + Intergenic
974550126 4:63361466-63361488 TTCTTCTTGGTCATTCTGTGTGG - Intergenic
974799461 4:66798462-66798484 TTCTTTTTGGTGCTTCTCTTAGG + Intergenic
975789747 4:77936141-77936163 TTATTACTGCTCTTTCTGTATGG + Intronic
976707280 4:88032612-88032634 TCCTTTCTGGTCCTCATTTAAGG + Intronic
976897139 4:90127012-90127034 TTTTTTCTCTTCCTCCTGTAAGG - Intergenic
977243801 4:94605238-94605260 TTCTTACTGGTCCTACAGGATGG + Intronic
979280042 4:118856902-118856924 CTCTTTCTTTTCATTCTGTATGG + Intronic
980885663 4:138759701-138759723 TAATTTCTGGTGCTGCTGTAGGG + Intergenic
981508757 4:145531832-145531854 TTTTTTCTGTTACTTCTATATGG + Intronic
981928630 4:150166855-150166877 TTTTTTCAGATCCTTCTGAATGG + Intronic
982892052 4:160867364-160867386 TTCTTCCTGGCCCTTTTATAAGG + Intergenic
982898934 4:160972961-160972983 TTCTTTCTGGATTTTCTGTGTGG - Intergenic
984061745 4:174997210-174997232 TTCCTTGTTGACCTTCTGTAGGG - Intergenic
984391160 4:179135159-179135181 TTCTTTCTGATCATCCTGAAAGG - Intergenic
984761997 4:183370506-183370528 TTCTTTCTGATTCTTCTCCATGG - Intergenic
986524828 5:8662836-8662858 TTGTTTCTGGTGTGTCTGTAAGG + Intergenic
987313419 5:16701782-16701804 TTCCTTCTGGCTCTTCTGCAAGG + Exonic
987445657 5:18016020-18016042 TTCTTTCTGGTACTTTTGTGCGG + Intergenic
987664174 5:20915286-20915308 TTCTTTCTGGCACTTTTGAAGGG - Intergenic
988252988 5:28784431-28784453 TTTTTTTTGGTCTTTATGTATGG - Intergenic
988348798 5:30073670-30073692 TTCCTTCTGGTGCTCTTGTAAGG - Intergenic
989229159 5:39066775-39066797 TGCATTCTGTTCATTCTGTAGGG - Intronic
989270679 5:39528861-39528883 TACTTTCTGGTCCCTCTATTAGG + Intergenic
992225820 5:74619030-74619052 TTCTTTCTGCTCCTCGTGGAGGG + Intergenic
993478819 5:88397466-88397488 CTCTTTCTGGCCCTTCTCTATGG - Intergenic
993707336 5:91185968-91185990 TTCTTTTTGGCCCCTCTGTTTGG - Intergenic
994630516 5:102280134-102280156 TACTTCCTGTACCTTCTGTATGG - Intronic
994861358 5:105199779-105199801 TTCCTTCTGGACCTCTTGTAAGG - Intergenic
998732966 5:145102218-145102240 TTCTTTCTCATCCTTCTGGAAGG + Intergenic
999289441 5:150414057-150414079 TTCTTAGTGGTCCTTGTGTCAGG - Intergenic
999380363 5:151117179-151117201 TTCTTGCTGCTCCTGCTGCAGGG - Exonic
999542459 5:152588323-152588345 TTCTTTCAGGTGCTCTTGTAAGG - Intergenic
999837466 5:155389970-155389992 TTCTTCCTGGACCCTATGTAGGG - Intergenic
1004157994 6:13187626-13187648 CTCTTTCTGCTCCTTCTACATGG - Intronic
1005138782 6:22602253-22602275 TTCTGTCTGCTCCATCTGGATGG + Intergenic
1006009800 6:31032715-31032737 TTCTCTCTGGTCCTTATATCAGG - Intronic
1007115034 6:39337315-39337337 TTCTTTCTTTTCTTTCTGGACGG + Intronic
1007334261 6:41140576-41140598 TTCTTTGTGTTCCTTCTTTCAGG + Intergenic
1007407800 6:41644839-41644861 CTCTTTCTGGTCTCTCTGTGGGG + Intronic
1008066561 6:47055800-47055822 TTGTTTCTGCTTCTTCTTTATGG + Intergenic
1008208329 6:48689408-48689430 TTCTTTCAGGAGCTTTTGTAAGG - Intergenic
1008464983 6:51820369-51820391 TGCTTGCTGCTCCTTCTATAGGG - Intronic
1008621385 6:53274788-53274810 TTCTTTCTGGTCCTTCTGTATGG - Intronic
1009253466 6:61342832-61342854 TTCTTTCTAGTTTTTATGTAAGG - Intergenic
1009258152 6:61444653-61444675 TTCTTTCTAGTTTTTATGTAAGG - Intergenic
1009336268 6:62493994-62494016 TTCTTTCAGGAGCTTTTGTAAGG - Intergenic
1010495525 6:76530566-76530588 TCCTTTCAGGACCTTTTGTAAGG + Intergenic
1011137672 6:84117572-84117594 TTCTTTCTGGTTCTCATGTTTGG + Intergenic
1011321307 6:86096243-86096265 TTCTTTCAGGAGCTCCTGTAAGG - Intergenic
1011534416 6:88360648-88360670 TTCCTACTGTTCCTTCTGTGAGG + Intergenic
1011549014 6:88511993-88512015 TTCTTTGTGGTCCTAATGGAGGG + Intergenic
1012318332 6:97809295-97809317 TTCTTTCTAGTCATTCTTTTTGG - Intergenic
1013040475 6:106427922-106427944 TGCTTGCTGTTCCCTCTGTATGG + Intergenic
1013314582 6:108929381-108929403 TTGTTTCTGGGCATTCTGTTTGG + Intronic
1013987548 6:116213795-116213817 CTCTTTCTGATCCTTTTGCAGGG - Intronic
1014367344 6:120561368-120561390 TTCTTTCAGGAGCTTCTGCAGGG + Intergenic
1014556470 6:122846799-122846821 TTCTTTGTGTTTCTTCTGTTTGG + Intergenic
1014758627 6:125329802-125329824 TTCTTGCTGGTCCCTCTGCTTGG - Intergenic
1015067548 6:129049706-129049728 TTCTTTCTGGGTCTTAAGTATGG - Intronic
1015420810 6:133006142-133006164 TTCTTTCTCATGCTTCTGTGTGG + Intergenic
1015622099 6:135141940-135141962 TACTTTCTGTTCCTTCTGCTAGG + Intergenic
1015910550 6:138164392-138164414 CTCTTGCTAGTCCTTCTGTAGGG + Intronic
1016716598 6:147239467-147239489 TTCTTTTGTGTCCTTCTGGAAGG + Intronic
1020377014 7:7499346-7499368 TGCTTTCTGGTTCTTCTGGCAGG - Intronic
1021008469 7:15430838-15430860 ATCTTTCTTTTCCTTCTGTAAGG - Intronic
1021009701 7:15446807-15446829 TTCTTTCTGGGCTGTCTTTAAGG + Intronic
1021836875 7:24685601-24685623 TTATTCCTGTTCCATCTGTATGG + Intronic
1022166733 7:27772959-27772981 TCCTTTCTGGTTCAACTGTAAGG + Intronic
1022663945 7:32392156-32392178 TTCTTTATAATCTTTCTGTAAGG - Intergenic
1022802010 7:33785823-33785845 TTCTTTCTGCCACTTCGGTATGG + Intergenic
1022869336 7:34459187-34459209 TTCTTTCTGGAGCTCTTGTAGGG - Intergenic
1024714032 7:52054135-52054157 GTGTTTCTGTTCCTTCTCTAAGG + Intergenic
1025274813 7:57570527-57570549 TTCTTTCTGGTTTGTCTGTCAGG + Intergenic
1025536761 7:61957743-61957765 TTCTTTCTAGTTTTTATGTAGGG - Intergenic
1025571245 7:62572489-62572511 TTCTCTCTGGTTTTTATGTAAGG + Intergenic
1026152852 7:67802894-67802916 TCCTTGCTGGTCTTTCTGTGTGG - Intergenic
1026229568 7:68471168-68471190 TTCTTTCTGGTACTTCAATCAGG + Intergenic
1026332643 7:69366145-69366167 TTCTCTGTGATCCTTCTCTACGG - Intergenic
1028915169 7:96251144-96251166 TACTTCCTCTTCCTTCTGTAAGG - Intronic
1029339749 7:99933315-99933337 TGCTTTCAGGGCCTTCTGGAGGG + Intergenic
1029904589 7:104078546-104078568 TACTTTCTGTTCCTTCAGCAAGG - Intergenic
1029975712 7:104831034-104831056 TTCTTTCTAGTCCTTTTCCAAGG - Intronic
1030396727 7:108995393-108995415 TTCTTTTTGGTCTCTCTGTGTGG + Intergenic
1030517317 7:110554105-110554127 TTCTTTCTTGTCCGTCTGCCAGG - Intergenic
1030636667 7:111957336-111957358 TTCTTTATCATCCTTTTGTATGG - Intronic
1030864184 7:114678512-114678534 TTCTTTTTGGTACTTCTCTCCGG + Intronic
1031039585 7:116825456-116825478 TCCTTTCAGGACCTTTTGTAAGG + Intronic
1031655698 7:124351909-124351931 TTCTTTCTGTTCCTTTTCAAGGG + Intergenic
1031996872 7:128238435-128238457 TTCTTTCCAGTCCGTCTGTGGGG - Intergenic
1033014527 7:137659098-137659120 CTCTTTCCTGTCCTTCTGTTTGG + Intronic
1033255534 7:139798217-139798239 TTCTTTCTTTTCCTTCTGGCTGG - Intronic
1033515404 7:142100517-142100539 TTCTTTCTTTTCCTTTTGAAAGG - Intronic
1033592527 7:142823478-142823500 TTATTTCTGGGCTTTCTGTTCGG + Intergenic
1034514399 7:151563227-151563249 ATTTTTTTGGTCCTTCTGTGAGG + Intronic
1035380464 7:158436878-158436900 TTCTTTGTGTTCATTCTGTGAGG + Intronic
1038051609 8:23819222-23819244 TTTTTCCTGGTCCTTTTGGATGG + Intergenic
1038436758 8:27541718-27541740 TTCTTGCTGGTGCTTCTCTTGGG + Intronic
1038904961 8:31890411-31890433 TTCTTTCTTTTCCTTTTGGAAGG - Intronic
1040113618 8:43588764-43588786 TTCTTTCTAGTTTTTCTCTAAGG - Intergenic
1040115584 8:43614736-43614758 TTCTTTCTGGTTTTTATGTGGGG - Intergenic
1040121921 8:43693332-43693354 TTCTTTCTGGTTTTTATGTGGGG - Intergenic
1040124298 8:43719458-43719480 TTCTTTCTAGTTTTTATGTAGGG - Intergenic
1040129043 8:43772922-43772944 TTCTTTCTAGTTTTTATGTAGGG - Intergenic
1040131354 8:43800636-43800658 TTCTTTCTAGTTTTTCTTTAGGG - Intergenic
1040131683 8:43804226-43804248 TTCTTTCTGGTTTTTATATAAGG - Intergenic
1040133212 8:43822064-43822086 TTCTTTCTAGTTTTTATGTAGGG - Intergenic
1040133902 8:43830038-43830060 TTCTTTCTTGTTTTTATGTAGGG - Intergenic
1040134851 8:43841120-43841142 TTCTTTCTTGTTCTTCTCTGGGG - Intergenic
1040281713 8:46055486-46055508 TTCTTTCTAGTTTTTATGTAGGG - Intergenic
1043292308 8:78618139-78618161 TTCTTTGGGGTTCTTCTGCATGG + Intergenic
1045137777 8:99240849-99240871 TTCTCTCTGGACCTGTTGTAGGG + Intronic
1046417217 8:113933488-113933510 TTCTTTATGATACTGCTGTAAGG + Intergenic
1046701087 8:117402003-117402025 TTCTTTCTGTCACTTCTGTCAGG - Intergenic
1047338678 8:123959222-123959244 TTCATTCTGTACATTCTGTAGGG - Intronic
1047529838 8:125664797-125664819 ATCTGGCTGGTCCTTCTGAAAGG - Intergenic
1047753603 8:127901023-127901045 TTCTTTCTGCTGCTTCTGCAAGG - Intergenic
1047794210 8:128237566-128237588 TTATTGCTAGTCCTTCTATATGG - Intergenic
1048154002 8:131924529-131924551 ATCTTTCTGATTCTTCTCTAAGG + Intronic
1049046153 8:140153330-140153352 TTCTTTCTGTCCCTTCTGCTTGG + Intronic
1052024424 9:23558820-23558842 TTCCGGCTGGTCCTTCTATAAGG - Intergenic
1052078824 9:24178278-24178300 TCATTTCTGGTCTTTCTGTTTGG + Intergenic
1053556531 9:39143559-39143581 TTCTTCCTGGAGCTTCTTTAGGG + Intronic
1053819186 9:41948956-41948978 TTCTTCCTCGTCAATCTGTAGGG - Intronic
1054109452 9:61092616-61092638 TTCTTCCTCGTCAATCTGTAGGG - Intergenic
1054611405 9:67238509-67238531 TTCTTCCTCGTCAATCTGTAGGG + Intergenic
1055547240 9:77391609-77391631 TTCTTTATAGTGCTTCCGTAGGG - Intronic
1056768687 9:89461164-89461186 TTTTTTCTGGTCATTTTGTAGGG - Intronic
1056948212 9:91018944-91018966 TTCTTTCAGCTCCTTCTATTTGG - Intergenic
1057700745 9:97361730-97361752 TTCCTCCTGGTCCTTCAGGATGG - Exonic
1057926542 9:99156560-99156582 GTCTTTCTAGTCTTTTTGTAGGG - Intergenic
1059862808 9:118483838-118483860 TGCTTTCTGCTCCTTGTCTAAGG - Intergenic
1060038043 9:120275329-120275351 TTCCTTCAGGACCTTTTGTAAGG + Intergenic
1060172426 9:121472959-121472981 TTCTTTCTGGAGCTTATCTATGG + Intergenic
1203626074 Un_KI270750v1:24386-24408 TTCTTTCTGGTTTGTCTGTAAGG + Intergenic
1188134589 X:26479717-26479739 TTCATTTTGGTCCTTTTGGAAGG - Intergenic
1188224261 X:27577374-27577396 TTCTATTTGGTCCCTCTGTCAGG - Intergenic
1189269097 X:39737950-39737972 TGTTTTCTTGTCCTGCTGTAAGG + Intergenic
1191577313 X:62720532-62720554 TTCTTTCTAGTTTTTGTGTAGGG + Intergenic
1191578378 X:62732661-62732683 TTCTTTCTAGTCCTTATCTTAGG + Intergenic
1191616068 X:63170571-63170593 TTCTTTCAGTTCCTTCTATCTGG - Intergenic
1191620229 X:63208352-63208374 TTCTTTCAGTTCCTTCTATCTGG + Intergenic
1191635957 X:63377014-63377036 TTCCTTCTGGAGCTCCTGTAAGG - Intergenic
1193080231 X:77399293-77399315 TGCTTTCTGGTACTTCTTCAGGG + Intergenic
1194569182 X:95531906-95531928 TTTTTTCTTTTTCTTCTGTATGG - Intergenic
1194942042 X:100022573-100022595 TTCTTTGTTGTCTTTCTGTCTGG - Intergenic
1195271480 X:103235561-103235583 TTCTTTCTGGTCCTTGCATGTGG + Intergenic
1195311411 X:103634904-103634926 TTGTCTCTGGTCCTTTTCTAGGG - Intergenic
1197366393 X:125568693-125568715 TTCTTTCAGGACCTCCTGTACGG - Intergenic
1199091728 X:143701211-143701233 TGCTTTCTGTTCATGCTGTATGG + Intergenic
1199305984 X:146268288-146268310 TTGTTTCTGTTCCTTCTGTTTGG - Intergenic
1199879325 X:151960651-151960673 GTCACTCTGGTCCTTCTGTGAGG + Intronic
1201364456 Y:13188007-13188029 TTCTTTCAGGACCTCTTGTAAGG - Intergenic