ID: 1008625057

View in Genome Browser
Species Human (GRCh38)
Location 6:53307244-53307266
Sequence TAACCACTACCACCCAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008625057_1008625059 -7 Left 1008625057 6:53307244-53307266 CCACTTTTGGGTGGTAGTGGTTA 0: 1
1: 0
2: 2
3: 9
4: 112
Right 1008625059 6:53307260-53307282 GTGGTTAGGAACATACACTTTGG 0: 1
1: 0
2: 6
3: 56
4: 362
1008625057_1008625060 8 Left 1008625057 6:53307244-53307266 CCACTTTTGGGTGGTAGTGGTTA 0: 1
1: 0
2: 2
3: 9
4: 112
Right 1008625060 6:53307275-53307297 CACTTTGGAGCCAGAGAGCCTGG 0: 1
1: 1
2: 5
3: 75
4: 523
1008625057_1008625061 9 Left 1008625057 6:53307244-53307266 CCACTTTTGGGTGGTAGTGGTTA 0: 1
1: 0
2: 2
3: 9
4: 112
Right 1008625061 6:53307276-53307298 ACTTTGGAGCCAGAGAGCCTGGG 0: 1
1: 4
2: 40
3: 224
4: 1105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008625057 Original CRISPR TAACCACTACCACCCAAAAG TGG (reversed) Intronic
906857192 1:49320660-49320682 TCACCACTATCACCCCAAACAGG + Intronic
909393475 1:75141432-75141454 TAACCATTCCCACCAAACAGGGG - Intronic
910565481 1:88638292-88638314 TGACTACTACTCCCCAAAAGAGG - Intergenic
911384128 1:97153810-97153832 TAAACAATCCCATCCAAAAGTGG + Intronic
912738072 1:112167869-112167891 CAACCACCACCACCAAAAACTGG + Intergenic
919535611 1:198783773-198783795 AAACTATTACCTCCCAAAAGAGG + Intergenic
924817151 1:247452446-247452468 CTACCACTACCTCCCAAAATGGG - Intergenic
1064223435 10:13461057-13461079 TACCCACTCCCACCCAATAATGG - Intronic
1065222011 10:23505653-23505675 TAAACACTGCCATCCAAAAGAGG - Intergenic
1065478764 10:26171165-26171187 TAACCACTACCAACCAAGGCAGG - Intronic
1068429268 10:56911250-56911272 GAACCACTACCACCAAGACGCGG + Intergenic
1068973095 10:62979757-62979779 CAACCTCTTACACCCAAAAGTGG + Intergenic
1069129072 10:64676385-64676407 TAAACAATTCCATCCAAAAGCGG - Intergenic
1069941223 10:71956785-71956807 TGACCACTACCACCAAAATGTGG - Intergenic
1073581389 10:104669043-104669065 CAAGCACTGCCACTCAAAAGTGG + Intronic
1076468466 10:130702187-130702209 TAACCAAATTCACCCAAAAGAGG + Intergenic
1076493328 10:130879026-130879048 AAACTACAACAACCCAAAAGCGG + Intergenic
1076912586 10:133399205-133399227 CCACCGCTACCACCGAAAAGAGG + Exonic
1077005545 11:353974-353996 GAACCACTACCACCAAGATGCGG + Intergenic
1078839421 11:15064543-15064565 AAACCAATTCCACCCAAATGTGG - Intronic
1083765429 11:64839230-64839252 TCACCACCACCACCCACAGGTGG - Exonic
1085271858 11:75274378-75274400 AGACCACTGCCACTCAAAAGAGG + Intronic
1093118141 12:15235918-15235940 AAACCAGTCCCACCAAAAAGTGG - Intronic
1094652366 12:32390591-32390613 AAACCTCTACTACCTAAAAGTGG + Intergenic
1096426363 12:51507141-51507163 TCACCACTACCACCCACTGGTGG - Intronic
1098610831 12:72455653-72455675 TGATCTCTACCACCCTAAAGGGG - Intronic
1101320221 12:103666706-103666728 ATGCCAGTACCACCCAAAAGTGG - Intronic
1104219549 12:126768672-126768694 AAACCACGACCAATCAAAAGTGG - Intergenic
1106796873 13:33215873-33215895 TAAACAATCCCACCAAAAAGTGG + Intronic
1107771780 13:43794513-43794535 TAACCTCTACCCCCAAAATGAGG + Intergenic
1111459744 13:88523339-88523361 TAGCCACTCCCACTCAAAAGTGG + Intergenic
1121732954 14:96198888-96198910 CAACCACACCCACCGAAAAGGGG + Intergenic
1128881942 15:71252007-71252029 AAATGACTCCCACCCAAAAGAGG - Intronic
1129728529 15:77916366-77916388 TGACCACTGCCTCCCAGAAGAGG + Intergenic
1130744351 15:86635204-86635226 TATCCCCTGCCACCCAAAATAGG - Intronic
1131028257 15:89163705-89163727 TGACCACTACCACCAAAGTGGGG - Intronic
1131569061 15:93514877-93514899 TAACCACTATGGCCCCAAAGGGG + Intergenic
1136749328 16:32618906-32618928 TAACTACTGCCACAAAAAAGGGG - Intergenic
1137880831 16:52046623-52046645 TAAGAACTACCATCCAAAAGAGG - Intronic
1203051460 16_KI270728v1_random:878120-878142 TAACTACTGCCACAAAAAAGGGG - Intergenic
1143874122 17:9979062-9979084 TAGGCAAAACCACCCAAAAGAGG + Intronic
1143984652 17:10901495-10901517 TAACCCCTACCTCCTAAAATTGG + Intergenic
1145121230 17:20261866-20261888 TCACCACTCCCATCCAGAAGAGG + Intronic
1146126192 17:30233369-30233391 TAACCACAGCCAACCAACAGGGG - Intronic
1148720921 17:49752597-49752619 TAACCATGACCACCCCACAGAGG + Intronic
1148806164 17:50265078-50265100 CAACCAGTGTCACCCAAAAGGGG + Intergenic
1156244147 18:35281944-35281966 GTACCACTACCACCGAAGAGGGG + Intronic
1158638410 18:59181380-59181402 TCACCAATATCACCCAACAGTGG - Intergenic
1159495534 18:69197649-69197671 TAAACACCACCATCAAAAAGTGG - Intergenic
1160074634 18:75661769-75661791 TACCCACCCCCACCAAAAAGAGG - Intergenic
1165426197 19:35746733-35746755 TGAGCACTATCACCCAGAAGAGG - Exonic
1166483252 19:43191315-43191337 GAACCACTACCACCAAGACGTGG + Intronic
1166485719 19:43210400-43210422 GAACCACTACCACCAAGATGCGG + Intergenic
1166717860 19:44980219-44980241 CCACCACAACCAGCCAAAAGGGG - Intronic
925333814 2:3078455-3078477 TAACCACAACAACCGAAAGGTGG - Intergenic
925475189 2:4205684-4205706 TAAACACTACTGCCTAAAAGAGG - Intergenic
927144036 2:20149402-20149424 TCATCACAACCACCCCAAAGTGG + Intergenic
930723160 2:54657275-54657297 ACACAACTACCGCCCAAAAGAGG + Intronic
930856548 2:56025116-56025138 TAACCAAAACCACCTTAAAGGGG - Intergenic
931757335 2:65385645-65385667 TACCCACTGCCACCAAGAAGTGG + Intronic
934518394 2:95003854-95003876 TATCCACTACCACACTCAAGAGG - Intergenic
935783817 2:106531306-106531328 TTCCCACTACCACTAAAAAGGGG - Intergenic
938896875 2:135760717-135760739 TAACCACTAGCAGCCAGTAGAGG - Intronic
945017098 2:205530274-205530296 TACCCACTACCACCCACAACAGG + Intronic
948854128 2:240722177-240722199 TCACCACTTCCACCCACAAGTGG - Intronic
948989191 2:241543264-241543286 TCAGCACTAACACTCAAAAGTGG - Intergenic
1177777807 21:25588758-25588780 TAACCAATAACAACCAAAGGGGG - Intronic
1179472050 21:41617503-41617525 TAACAACCATCACTCAAAAGAGG - Intergenic
1181913841 22:26263162-26263184 TTTCCACAACCACCCAAGAGGGG + Intronic
953171902 3:40514428-40514450 GAACCACTACCACCAAGATGCGG - Intronic
958098329 3:88975630-88975652 TAACCAAAAACATCCAAAAGAGG + Intergenic
958118126 3:89249100-89249122 TAACTTCTTCCACCCAAAAGTGG - Intronic
960749307 3:120928887-120928909 TAACAAAGACCACCCAAATGAGG + Intronic
961131823 3:124475553-124475575 TAATAACTTCCACCCATAAGGGG + Intronic
966962684 3:184955556-184955578 GAACCACTACCACCAAGACGCGG - Intronic
974947062 4:68541476-68541498 AAAACACCACCACCAAAAAGTGG - Intronic
976990761 4:91362232-91362254 TATCTACTACTACCAAAAAGGGG - Intronic
977271050 4:94917572-94917594 TAAACACTACCATTCTAAAGGGG - Intronic
977511128 4:97964253-97964275 TAAACACTAGCACACAAAATGGG + Intronic
977875773 4:102148463-102148485 TAAACACAACCACCAAAAAGGGG + Intergenic
978758557 4:112330455-112330477 TATGCACTACCACCCAAAGAGGG + Intronic
980629857 4:135417197-135417219 TAGCCACTACCAGACACAAGAGG + Intergenic
983767974 4:171511091-171511113 TAATTACTACCACCTAAAATGGG + Intergenic
986822036 5:11477980-11478002 TAAACTCTACCACCCAAAGCTGG - Intronic
987961354 5:24813551-24813573 CCACCATTACCACCCAACAGAGG - Intergenic
989806897 5:45619832-45619854 TAATCTCTACCACCCGAGAGAGG - Intronic
990968464 5:61476510-61476532 TAACCACTACATGCTAAAAGAGG + Intronic
993014705 5:82522194-82522216 AAACCACTACCACTCAAGGGTGG - Intergenic
997780241 5:136650506-136650528 AAACCAGTACCATCAAAAAGTGG - Intergenic
1000642866 5:163724441-163724463 TAACCACTACCACAAGCAAGAGG + Intergenic
1008625057 6:53307244-53307266 TAACCACTACCACCCAAAAGTGG - Intronic
1008664435 6:53702160-53702182 TAAACACTACCATCAAAATGAGG + Intergenic
1008835843 6:55828089-55828111 TAACCTCTATCACCTAAAGGTGG - Intronic
1015378856 6:132543976-132543998 TATCCACTACCAACCTAAAAGGG - Intergenic
1015878874 6:137851048-137851070 AAACCACCACCAACCAAAACAGG - Intergenic
1018209963 6:161471150-161471172 TAACCACTCCCTCTCAATAGAGG + Intronic
1018893695 6:167999545-167999567 GAACCACTACCACGCACGAGAGG - Intronic
1022511436 7:30937198-30937220 TAACCACTTCAAACCAAAATAGG + Intergenic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1024766438 7:52666789-52666811 AAAAAACGACCACCCAAAAGTGG + Intergenic
1026384194 7:69829546-69829568 AAAACACCACCACCAAAAAGTGG + Intronic
1027048228 7:75005195-75005217 TAACCACTGCCACACTCAAGAGG + Intronic
1030076084 7:105738045-105738067 TAACCACAACCACCTAAAAGGGG + Intronic
1030212655 7:107011615-107011637 TAACCACTGCAACACAAAATTGG - Intergenic
1031113323 7:117638174-117638196 AAACCACTGCCCCCCAAAATGGG - Intronic
1034729812 7:153377376-153377398 AAGCCATTACCACCCAACAGGGG - Intergenic
1035156746 7:156920494-156920516 GAACCACTACCACCAAGATGCGG + Intergenic
1036208531 8:6823524-6823546 CAACCACAAAAACCCAAAAGTGG + Exonic
1040057080 8:43068402-43068424 TAACCACCACCACCAACAAAAGG - Intronic
1040555882 8:48477231-48477253 TGAGCACTACCACCCACAAATGG - Intergenic
1045084284 8:98664260-98664282 TAACCACCACCAAAAAAAAGGGG + Intronic
1047501591 8:125445899-125445921 TAACCACTTCTCCCCAGAAGGGG - Intergenic
1049468609 8:142765028-142765050 TCACCACTGCCACCCGTAAGTGG - Exonic
1056250706 9:84745278-84745300 GAACCACTAACAACCAAAAGTGG - Intronic
1057327082 9:94075155-94075177 TCACCACCACCACCCAGCAGGGG + Intronic
1059090973 9:111357848-111357870 TAACCACTAATACCCAACATTGG + Intergenic
1061787874 9:133041639-133041661 GGACCACTACCACCAAAATGCGG - Intronic
1187755956 X:22526709-22526731 TCATCACTACCATCCTAAAGAGG - Intergenic
1192172182 X:68863377-68863399 AAACCACTACCACCCAAGAGAGG - Intergenic
1192914961 X:75642166-75642188 CAAACACCACCATCCAAAAGTGG - Intergenic
1192988073 X:76421711-76421733 TAACAAAAACCACCCAAATGTGG - Intergenic
1193597774 X:83468812-83468834 TTACCAAAACTACCCAAAAGAGG + Intergenic
1196468795 X:116001589-116001611 TAACCACTACCACCAACACAAGG - Intergenic
1196916230 X:120537627-120537649 TCACTACTAAAACCCAAAAGAGG + Intronic