ID: 1008628217

View in Genome Browser
Species Human (GRCh38)
Location 6:53338283-53338305
Sequence GGATGTGACAAGTGACAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008628217_1008628224 23 Left 1008628217 6:53338283-53338305 CCTTACTGTCACTTGTCACATCC 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1008628224 6:53338329-53338351 CCTATTCTAAGCCCTTGCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 97
1008628217_1008628219 -10 Left 1008628217 6:53338283-53338305 CCTTACTGTCACTTGTCACATCC 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1008628219 6:53338296-53338318 TGTCACATCCAACTTCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008628217 Original CRISPR GGATGTGACAAGTGACAGTA AGG (reversed) Intronic
900876460 1:5346154-5346176 TGATGTGACAGGTGAGAGTCAGG + Intergenic
901120296 1:6886135-6886157 GGATGGGGGAAGTGACAGTGGGG + Intronic
906818500 1:48903899-48903921 GGATGGAGCAAGTGACAGGAAGG + Intronic
909044436 1:70691722-70691744 GGATCTGATAAGTCACTGTAAGG + Intergenic
909345231 1:74577348-74577370 GGTTGACACAAGTGGCAGTAAGG - Intronic
911458926 1:98163951-98163973 GGATGGGACAAGGGACAGGAAGG - Intergenic
916620047 1:166487257-166487279 GTAAGTGACAAGTGAAGGTAAGG - Intergenic
917655551 1:177122102-177122124 GGATTTGGCAGGTAACAGTAGGG - Intronic
917917002 1:179712103-179712125 GGCTGTGATAAGTGCCATTATGG + Intergenic
918170657 1:181994248-181994270 GGATGTTTCAATTCACAGTATGG + Intergenic
918209247 1:182336396-182336418 AGTTGTGACAAGGGACAGAAGGG - Intergenic
918597833 1:186312984-186313006 GAATGTGAGAAGTTACACTACGG + Exonic
920244144 1:204575456-204575478 GGATGTGAGGAGAGACACTAGGG + Intergenic
921884922 1:220296135-220296157 GGAATTGGAAAGTGACAGTAGGG - Intergenic
1063659250 10:8022263-8022285 GGATGTGACACATGTCAGTGTGG + Intergenic
1064583300 10:16815479-16815501 GGATGTGACAAGAGAGAAGAAGG - Intronic
1065583043 10:27190846-27190868 GGATGAGACAGGTGAGAGAATGG + Intergenic
1066481170 10:35796820-35796842 GGAAGTGCAAAGTGACAGCAGGG - Intergenic
1066747990 10:38621241-38621263 AAATGTGACAACTGACAGCAAGG + Intergenic
1070677334 10:78421073-78421095 GGATGTGGGAAGTGAGAGGAGGG + Intergenic
1071921733 10:90357988-90358010 GGAGGTGACAACTGACATCAGGG - Intergenic
1074932812 10:118146314-118146336 GGATGTGAGAGGTGGCAGTGGGG - Intergenic
1075737876 10:124675153-124675175 GGCTGTGACTAGAGACAGAAAGG + Intronic
1077429672 11:2509880-2509902 GGAGGTGACAAGTGACAGCCGGG + Intronic
1078693512 11:13605857-13605879 GGAAGACACAAGTGACAGAATGG - Intergenic
1084323669 11:68387049-68387071 GGATGACAGTAGTGACAGTAAGG + Intronic
1087867919 11:103256098-103256120 AGATGTGGCAAGTGTCTGTAGGG - Exonic
1088328769 11:108628838-108628860 GGATGTGCCAAATGGCAGGACGG - Intergenic
1089884642 11:121808061-121808083 GGATTCAACAAGTGAAAGTAAGG - Intergenic
1094814808 12:34172379-34172401 GGAAGTGACAGGTGATAATAGGG - Intergenic
1095084024 12:38040631-38040653 GGATATTACAAGGCACAGTAAGG + Intergenic
1095102121 12:38196199-38196221 GGATGTGACAGATGATAATAGGG + Intergenic
1098198315 12:68026236-68026258 GAATGTGAGAAGTGACAGTCCGG + Intergenic
1098257317 12:68630277-68630299 GGTTGTGATAAGAGACTGTATGG - Intronic
1099035701 12:77584982-77585004 GGATGATACAACTGAAAGTAGGG + Intergenic
1100145367 12:91671161-91671183 GGATATGCCAAGTAACAGTAGGG + Intergenic
1100214040 12:92429088-92429110 GTGTGTGACAAGTGAAAATAAGG + Exonic
1102631575 12:114285539-114285561 AGAAGTGAGAAGTGACAGGAGGG - Intergenic
1106640387 13:31578523-31578545 GGAAGTGCCATGTGACAGTGGGG + Intergenic
1108072549 13:46643118-46643140 GGCTGTGAAAAGGTACAGTAGGG - Intronic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1110275145 13:73634325-73634347 GGATGTGAGAAGGGAATGTATGG + Intergenic
1110277111 13:73652887-73652909 GGATGTGACACGTGACTTCAAGG + Intergenic
1110600458 13:77366540-77366562 GGATGTTTCAACTGACAGCAAGG + Intergenic
1111097787 13:83537154-83537176 GGAAGTAAGAAGTGAAAGTAGGG + Intergenic
1111632455 13:90859711-90859733 GGAAGGGATAAGTGACAGAACGG - Intergenic
1112764923 13:102731175-102731197 TGATGTTTCAAGTGACAGTGAGG - Exonic
1113345503 13:109473944-109473966 AGATGTAACAACTGACAGAATGG - Intergenic
1114689481 14:24566869-24566891 GTCTGTGACAAGAGACAGCAGGG - Intergenic
1118150709 14:63187095-63187117 TGAGGTTACAAGGGACAGTAGGG + Intergenic
1118229798 14:63937318-63937340 GGATGGGAGAATTAACAGTATGG + Intronic
1119984654 14:79123682-79123704 GGATGTGAAAATGGACAGAAGGG + Intronic
1120373840 14:83674423-83674445 GGATCTGAGAAGTCACAGTAAGG + Intergenic
1122892665 14:104740069-104740091 GGGTGTGACAGGTGACGGTAGGG - Intronic
1125888061 15:43243746-43243768 GGATGTGTTCAGTGACAGCAAGG - Intronic
1129762281 15:78136824-78136846 GGATGTGAGAAGTTACTGGATGG + Intronic
1131074370 15:89486111-89486133 GGAGCTGAGAAGTGACAGTAGGG + Intronic
1134030922 16:10991687-10991709 TGATGTGACAAGTCTCGGTACGG + Intronic
1135013753 16:18906564-18906586 GTATTTGAAAAGTTACAGTAAGG - Intronic
1135320698 16:21494134-21494156 GTATTTGAAAAGTTACAGTAAGG - Intergenic
1135438256 16:22445078-22445100 GTATTTGAAAAGTTACAGTAAGG + Intergenic
1135671781 16:24381858-24381880 GGAGGTGACAAGAGAGAGAAGGG + Intergenic
1136445550 16:30315562-30315584 GTATTTGAAAAGTTACAGTAAGG - Intergenic
1138144375 16:54595580-54595602 GGCAGTGAGAAGTGACAGCAAGG + Intergenic
1139098254 16:63732450-63732472 GGATTTGACAAGTGAGCATATGG + Intergenic
1141599404 16:85116107-85116129 GGATGTGGCAAGTGAGCCTATGG - Intergenic
1144789363 17:17848817-17848839 GGGTGTCACAAGTGAAGGTATGG - Exonic
1145980473 17:29008187-29008209 TGATGTGACAAGTTCCAGGATGG - Intronic
1146535893 17:33651844-33651866 GGATGTGACAAAAGAGAGTGAGG + Intronic
1148694154 17:49549165-49549187 AGATGTGACAAGTGACAGGAAGG + Intergenic
1153148701 18:2064479-2064501 GGTTGTCACAAGAGACAGGAAGG + Intergenic
1157020750 18:43778687-43778709 GGAAATGACAATTGACAGCATGG - Intergenic
1157329864 18:46695971-46695993 GGAAGTGGCAAGTGCCAGGAAGG + Intronic
1164932801 19:32188175-32188197 GGATGTGGCAGGTGACAGAGAGG - Intergenic
1166677076 19:44747149-44747171 GGATGTGAGAAGTGGCTGTGTGG - Intergenic
1167573869 19:50308420-50308442 TGATGTGCCAAGTGCCAGGATGG + Intronic
1168290340 19:55354353-55354375 GGGTGTGACAAGGGACGGCAGGG - Exonic
926049611 2:9736251-9736273 AGATGGGACAAGTTACAGGAAGG - Intergenic
928069691 2:28202318-28202340 GGATGTGGGAAGAGACAGGAAGG - Intronic
929777190 2:44936865-44936887 TGTTATGACAAGTGGCAGTAGGG - Intergenic
931799163 2:65741728-65741750 GGATGTGACAAGTGGATTTATGG + Intergenic
936833487 2:116678485-116678507 GGATGAGAAAGGTGACAGGAAGG + Intergenic
937937775 2:127259795-127259817 GGAAGGGACAAGTGACTGGAAGG + Intronic
942890876 2:180986142-180986164 GGTTGTGACAAGGGAAAGCAGGG - Intronic
943717632 2:191169746-191169768 GGAAGAGACAAGTCACAGTATGG + Intergenic
945694371 2:213084084-213084106 GCAGGTGACAAGTGTCAGTTTGG - Intronic
1169649310 20:7849269-7849291 GGAAGTGACAAATGAAAGGAGGG + Intergenic
1170283932 20:14684157-14684179 GGCCGTGCCAAGTGAGAGTAAGG + Intronic
1172043193 20:32060601-32060623 GGATATGAGATATGACAGTAAGG - Intronic
1172997850 20:39083947-39083969 GAATGTGACAAGTGGCAGATGGG + Intergenic
1173882122 20:46423442-46423464 GGATGAGACAAGAGACAGGAAGG - Intronic
1177085182 21:16694697-16694719 GGATGTGAGAAGTGAAGTTAAGG - Intergenic
1177772028 21:25527554-25527576 GTAATTGACAACTGACAGTATGG - Intergenic
1179948161 21:44694389-44694411 AGAAGTGACCAGTGACAGTGGGG + Intronic
1182780348 22:32862523-32862545 GCATGTGACAATTGACAATCTGG + Exonic
1183371400 22:37434613-37434635 GGAAGTGACAAGCGATTGTAGGG - Intergenic
1184052531 22:42018541-42018563 GGATTTGATGAGTGACAGTAAGG + Intronic
951797744 3:26560021-26560043 AGATGAGAAAAGTGTCAGTACGG + Intergenic
953025854 3:39144506-39144528 GGGTTTGTCTAGTGACAGTAGGG - Intronic
953452000 3:43013474-43013496 GGCTGTGTCAAGTCACAGGAAGG + Intronic
955473876 3:59315167-59315189 GGATGGTAAGAGTGACAGTAAGG - Intergenic
955489804 3:59470874-59470896 GGCTGTTACAAGAGAAAGTAAGG + Intergenic
955531488 3:59877496-59877518 TAAAGTGACAAGTGACAGGAGGG + Intronic
963823673 3:149927883-149927905 GAAAGTGACAACTGACAGAATGG - Intronic
964518108 3:157534393-157534415 GGCTGTGAGAAGTGTCAGAAAGG - Intergenic
964886270 3:161486677-161486699 GAATGTTACAAGTGACAGTCAGG - Intergenic
967979866 3:195059306-195059328 GGGTGTCACAGGTGACAGGAGGG + Intergenic
968479827 4:828389-828411 GGATGTAACAAGTAACAACAGGG - Intergenic
969623667 4:8291662-8291684 GGATGTGTCGAGTGCCAGAATGG - Intronic
971960796 4:33484641-33484663 GGATGAAATAAGTAACAGTATGG + Intergenic
972047049 4:34679352-34679374 GGAAGTAACAAGTCACAGCATGG + Intergenic
974809041 4:66921696-66921718 GGAGGAGACAAGAGACAGGAAGG + Intergenic
976124492 4:81819060-81819082 GGATGTGAGAAGTAAAAGAAAGG + Intronic
976563793 4:86531065-86531087 GGATGTGCCAAGTGATAGCTTGG - Intronic
977071139 4:92389285-92389307 AGATGTGGAAAGGGACAGTATGG + Intronic
978437007 4:108696343-108696365 GGATGACGCAAGTGACAGCAAGG + Intergenic
978570250 4:110129307-110129329 GGAGGTGACAGATGACACTAGGG - Intronic
978693629 4:111547470-111547492 GTATGTGAAAAGTGACATTTTGG + Intergenic
981956378 4:150478852-150478874 AGCTGTGATAAGTGACAGGAAGG - Intronic
982719311 4:158843185-158843207 GGATGGCATAAGTGATAGTATGG - Intronic
984352517 4:178613663-178613685 GGATGTGAAAAGTGAGCTTATGG - Intergenic
988174857 5:27708855-27708877 GGGAGTGATAAGTGACAGAAAGG + Intergenic
989277746 5:39609506-39609528 GGATGTGACAATAGCCAGGATGG + Intergenic
990032015 5:51273070-51273092 GGCTGTGCCAAGTAACAGAAGGG + Intergenic
994437431 5:99756118-99756140 GGTTGTGAAAAGAGACACTAAGG + Intergenic
995728061 5:115203121-115203143 GGATATGCCCAGTGACTGTAGGG + Intergenic
996506579 5:124275049-124275071 GGAGGTTAAAGGTGACAGTAGGG + Intergenic
1001154119 5:169258206-169258228 GGATGTGATAAGTGAAACTATGG - Intronic
1007152462 6:39707527-39707549 GGACCTGAGAAGTGACAGAATGG - Intronic
1007355467 6:41312172-41312194 GGATGAGAAAAGAGAAAGTATGG - Intergenic
1008628217 6:53338283-53338305 GGATGTGACAAGTGACAGTAAGG - Intronic
1009612160 6:65959779-65959801 TGATGTGCTAAGTGACTGTATGG + Intergenic
1010564485 6:77392649-77392671 GGAAGTGACTAGTGACTATAGGG - Intergenic
1012246036 6:96926619-96926641 GGATCTGACAAGTGAGATAAAGG + Intronic
1012432689 6:99182462-99182484 AAATGTGACAAATGACTGTAGGG + Intergenic
1017217794 6:151930431-151930453 CTATGTCACAAGGGACAGTAAGG - Intronic
1017682716 6:156880213-156880235 GGATGTGATAAGAGAGAGAAGGG + Intronic
1020499756 7:8902779-8902801 TGATGTGTCAAGTGACACTGTGG - Intergenic
1022157581 7:27675718-27675740 GGATGAGAAAAGTCACAGTTGGG - Intergenic
1023897035 7:44442544-44442566 GGAGGGGACAAGTGACAAGATGG + Intronic
1024145617 7:46513642-46513664 AGATGTGACAAGACACAGCAGGG - Intergenic
1024527012 7:50357442-50357464 GGTTGTGAGAAGTCACAGAAGGG - Intronic
1028202815 7:87982358-87982380 GGAGGTGACATTTGAAAGTAAGG + Intronic
1030372798 7:108719449-108719471 GGATGAGAGAAGTGGCAGTGGGG - Intergenic
1031213627 7:118861762-118861784 CTATGTGAAAACTGACAGTAGGG + Intergenic
1032695562 7:134333220-134333242 AGATGGGACAAGGGACAGTTGGG + Intergenic
1034478169 7:151300709-151300731 GGATGTGTTGAGTGACAGCATGG + Intergenic
1037731433 8:21527080-21527102 GGATGTGATAACTGAATGTAAGG - Intergenic
1038064668 8:23951351-23951373 GGTGGTGACAGGTGACAGTTGGG - Intergenic
1043925104 8:86027878-86027900 GGATGAGACAAGTAGCAGTACGG - Intronic
1044392146 8:91663671-91663693 GGATGTGAGAAGAGAAAGCAAGG - Intergenic
1045682204 8:104674376-104674398 GGAAGACACAAGTGCCAGTAAGG - Intronic
1045772282 8:105756965-105756987 GAATGTGACAAATGAAATTAGGG + Intronic
1053113569 9:35482520-35482542 GGGGGTGACAAGAGACAGTATGG + Intergenic
1056027302 9:82512213-82512235 GGATGTGACAAGTATCTTTAAGG + Intergenic
1057587067 9:96338064-96338086 TGAGGTGACAGGTGACAATAAGG + Intronic
1059463260 9:114448851-114448873 GGAAGTGACAAGGCACAGCAGGG - Intronic
1059741962 9:117160356-117160378 GGATGGGAAAAGTGACAATGAGG - Intronic
1188487186 X:30695187-30695209 GGATCTGTCAAGTGAGAGTGGGG - Intronic
1188555263 X:31404760-31404782 GGATGTGAGAAGAAACAGGAGGG + Intronic
1188906944 X:35801158-35801180 GCCTGTGAAAAGTCACAGTAAGG + Intronic
1189279537 X:39811559-39811581 GCATGGGACAAATGACAGCATGG + Intergenic
1195755690 X:108196696-108196718 GGCAGTGACAAGAGACAGCATGG - Intronic
1195802331 X:108726845-108726867 TTCTGTGCCAAGTGACAGTAGGG + Intronic
1196480274 X:116140285-116140307 GGCAGTGGCAAGTGACAGTGAGG - Intergenic
1199759321 X:150893161-150893183 GGATGTGACCTATGACAGCAAGG + Intronic