ID: 1008628220

View in Genome Browser
Species Human (GRCh38)
Location 6:53338304-53338326
Sequence CAGTGTGACCCAAGGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008628220_1008628224 2 Left 1008628220 6:53338304-53338326 CCAACTTCCCTTGGGTCACACTG 0: 1
1: 0
2: 0
3: 22
4: 180
Right 1008628224 6:53338329-53338351 CCTATTCTAAGCCCTTGCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008628220 Original CRISPR CAGTGTGACCCAAGGGAAGT TGG (reversed) Intronic