ID: 1008628220

View in Genome Browser
Species Human (GRCh38)
Location 6:53338304-53338326
Sequence CAGTGTGACCCAAGGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008628220_1008628224 2 Left 1008628220 6:53338304-53338326 CCAACTTCCCTTGGGTCACACTG 0: 1
1: 0
2: 0
3: 22
4: 180
Right 1008628224 6:53338329-53338351 CCTATTCTAAGCCCTTGCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008628220 Original CRISPR CAGTGTGACCCAAGGGAAGT TGG (reversed) Intronic
900880344 1:5377049-5377071 CAGTGAGACCCGAGGGCAGCTGG - Intergenic
902071620 1:13744257-13744279 TGCTGTGACCCAAGGCAAGTAGG + Intronic
903926093 1:26831761-26831783 CACTGTGACCCAAGGTAGGCAGG - Intronic
904437319 1:30507228-30507250 CAGTGTGACCCTGTGCAAGTGGG - Intergenic
906839726 1:49123703-49123725 CACTGAGACCCAAGGAGAGTAGG - Intronic
908359667 1:63356735-63356757 CAGTGTGTCCCATGGCTAGTGGG - Intergenic
912384595 1:109264978-109265000 CAGTATGGCCCAAGGTAATTTGG - Exonic
912545919 1:110451392-110451414 CAGTGTGAACCAAAGGGAATGGG + Intronic
913122478 1:115754584-115754606 CTGTGTGTCCCCAGGCAAGTTGG - Intronic
913379422 1:118192389-118192411 CAGTTTGACCCAAGAACAGTAGG - Intergenic
915094994 1:153456214-153456236 AGGTGTGGCCCAAGGAAAGTGGG + Intergenic
917276258 1:173334905-173334927 AAGTGTGACCCAAGAGGAGGTGG + Intergenic
919494392 1:198246239-198246261 CAAAGAGACCCAAGGGTAGTTGG + Intronic
919732065 1:200919676-200919698 CTGTTTGCCCCAAGTGAAGTCGG - Intergenic
922065624 1:222136893-222136915 TATTGTGACCTAAAGGAAGTCGG + Intergenic
922823562 1:228501662-228501684 CAGTGTGACCCAAGGCCACCAGG + Intergenic
923498547 1:234545449-234545471 CAGTGTGAGCCTGGGGGAGTGGG - Intergenic
924027075 1:239844932-239844954 CAGTGTGAACTAAGGAAAGAGGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063607674 10:7537148-7537170 CAATGTGACGCAGGGTAAGTAGG - Intergenic
1063702209 10:8395318-8395340 CAATATTAACCAAGGGAAGTGGG + Intergenic
1067099622 10:43325144-43325166 CAGTGTGAGCCATGGGTGGTGGG + Intergenic
1069818975 10:71216121-71216143 CAGTGTGACCTTGGGCAAGTTGG - Intronic
1070491695 10:76982514-76982536 CAGTTTGAACCAAGGCAAGGTGG + Intronic
1070588618 10:77785607-77785629 CATTGTTACCCCATGGAAGTTGG + Intergenic
1070599786 10:77857521-77857543 CAGTGTGACGCAATTCAAGTTGG + Intronic
1070789411 10:79180554-79180576 CAGTCTGGCCCAAAGGAAGTGGG + Intronic
1076276109 10:129200111-129200133 CAGTGTTCTCCCAGGGAAGTGGG - Intergenic
1076659278 10:132044548-132044570 CAGTGTGGCCCAAGGGAGCTGGG + Intergenic
1076901819 10:133343100-133343122 CAGTGTGACTCAAGGAAGATAGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1085127445 11:74011310-74011332 CCCTGGGCCCCAAGGGAAGTGGG + Intergenic
1085447003 11:76607625-76607647 GAGTGTGCCCCAAGGGGTGTAGG - Intergenic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1089399484 11:118156233-118156255 CAGCATGCCCCAGGGGAAGTCGG + Intergenic
1090055290 11:123418280-123418302 CAGGGTTTCCCAAGGGGAGTTGG + Intergenic
1092615965 12:10215708-10215730 CATTGTGCCCCAAAGGAACTCGG - Intronic
1093780859 12:23135783-23135805 AGGAGTCACCCAAGGGAAGTAGG + Intergenic
1093859114 12:24141805-24141827 AAATGTGACCAAAGGCAAGTTGG + Intergenic
1101506530 12:105351942-105351964 CAGTGTGACACATGGGATGAGGG + Intronic
1102108877 12:110349086-110349108 CTGTCTGGACCAAGGGAAGTGGG - Intronic
1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG + Intergenic
1104687169 12:130793997-130794019 CAGTGTGACCCCTGGGGAGTGGG - Intronic
1105432009 13:20345196-20345218 CAGTGTGACCCCTGGGATGAGGG + Intergenic
1105621596 13:22072720-22072742 CAGTGTGAGCCAGTGGAAGGAGG - Intergenic
1105948671 13:25210713-25210735 CTGTGTGACCCTAGGGCAGGAGG + Intergenic
1106327932 13:28711991-28712013 CAGTGTGACCAAATAGAATTGGG - Intronic
1108109619 13:47054877-47054899 AAATGAGTCCCAAGGGAAGTGGG - Intergenic
1108590065 13:51905448-51905470 CAGAGCAACCCAAGGGAAGCCGG + Intergenic
1109080103 13:57888168-57888190 CACTGGGACCCAAGAGAATTTGG + Intergenic
1112379953 13:98879254-98879276 CAGTGGGAACCAGGGGAAGCAGG + Intronic
1112862500 13:103849923-103849945 CAGGGCGAACCATGGGAAGTGGG + Intergenic
1114423032 14:22600515-22600537 CAGTGTGGGCCAAGGGGATTTGG + Intronic
1116815654 14:49581258-49581280 AAGTGTGACAGAAGGGAAGCTGG - Intronic
1116863001 14:50009254-50009276 CAGTGTGACCCTAAGGATGCCGG + Intergenic
1118710157 14:68512214-68512236 CAGTGTGGCCCAAAGGAATCTGG + Intronic
1119446025 14:74664023-74664045 CAGTCTGACCCAGGAGGAGTTGG - Exonic
1120733456 14:88027891-88027913 CAGGGTGGCCCCAGGGAAGGAGG + Intergenic
1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG + Intergenic
1122215613 14:100201951-100201973 CAATGTGAGCCCAGGGAAGTGGG + Intergenic
1122942656 14:104989336-104989358 CACTGAGACCCAAGGGGAGCTGG - Intronic
1125318137 15:38454296-38454318 CACAGAGGCCCAAGGGAAGTAGG - Intronic
1126347889 15:47716230-47716252 CTGTGTAACCCAAGGAAAGAAGG - Intronic
1127190140 15:56521048-56521070 CACTGTGGTCCAAGGTAAGTTGG - Intergenic
1127295323 15:57604156-57604178 CAGTGTTCCCCAATGGAAGTAGG + Intronic
1128648019 15:69391223-69391245 AAGTGTCACCCAAAGGAATTTGG - Intronic
1128893246 15:71349843-71349865 CAGTGTGGGCCCAGGGAAGGGGG + Intronic
1129230556 15:74194966-74194988 CAGCCTGACCAAAGGGAAGCTGG + Intronic
1132232252 15:100192903-100192925 AAGTGTGGCCCATGGGCAGTGGG - Intronic
1135087757 16:19488494-19488516 CAGTGGAGCCAAAGGGAAGTGGG - Intronic
1140468902 16:75204058-75204080 CTGTGTGGCCCAGGGGAGGTGGG - Intergenic
1140933464 16:79649682-79649704 CAATGAGACCCAAGGCAAGGGGG - Intergenic
1141426865 16:83949792-83949814 CAGTTTTACCCAGGGGAAATGGG - Intronic
1143384926 17:6523521-6523543 CAGTGAGAGCTAAGGGCAGTCGG - Intronic
1146268080 17:31466220-31466242 CAGTGGGTCCCAGGGGAAGGAGG + Intronic
1151324758 17:73372271-73372293 CAGTGTGCCCCATGGGAACCAGG - Intronic
1153988310 18:10372815-10372837 CAGTTTAAACCAAGAGAAGTCGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156133745 18:34009902-34009924 CACTGTGATCCAATGGAATTAGG - Intronic
1158612280 18:58952203-58952225 CTCTGTGACCCAGGGGAACTCGG + Intronic
1160155250 18:76429027-76429049 CAGGCTGACCCCGGGGAAGTTGG + Intronic
1160920161 19:1515832-1515854 CAGTGGGACACAAGGGACCTCGG + Intergenic
1162057373 19:8072658-8072680 CACTGTGCCCCCAGGGATGTGGG + Intronic
1162099806 19:8333041-8333063 CAGTGTGTCCCACGGGAACCTGG - Exonic
1162153268 19:8660178-8660200 CTGTGTGACCCTAGGCAAGTCGG + Intergenic
1164483166 19:28632213-28632235 CAATGGGACCCAAGGAAAGCAGG + Intergenic
1166426704 19:42685397-42685419 AAGAGTGACCCAAGGAAAGTGGG + Intronic
1166519618 19:43471644-43471666 CAGTGTGTCCCAGAGGGAGTGGG - Intergenic
1166766137 19:45252717-45252739 CAGATTGACCCAAGGGAAAAGGG - Intronic
931558434 2:63530865-63530887 CAGTGTGAGCCAAAGCAAGGCGG + Intronic
931893211 2:66698698-66698720 CAGTCTGACCAAAGAGAAGAAGG - Intergenic
932260225 2:70320791-70320813 CAGTGGGATTCAAGGGCAGTGGG + Intergenic
937144234 2:119628375-119628397 CATTGTGCCCGAAGGGAAGAAGG - Intronic
939431374 2:142113184-142113206 CACTGGGAACCAAGAGAAGTGGG - Intronic
941181295 2:162262509-162262531 CAGTGTAACCCAATTGAAGCTGG - Intergenic
941473570 2:165920899-165920921 CAGTTTCACTCAAGGGAAGTTGG - Intronic
942482058 2:176399136-176399158 CAGTGTAAGCCAAAGGCAGTGGG + Intergenic
943581009 2:189683546-189683568 CAGTGTGACTCATGGAAACTTGG + Intronic
946663912 2:222029684-222029706 CAGTGTTCCTCAAGGGAAGAGGG + Intergenic
948154657 2:235771449-235771471 CAGGGTGACCTAAGGCATGTGGG + Intronic
1169268090 20:4179866-4179888 CAATGTGACCCAAGGAAAATCGG - Intronic
1170261002 20:14408400-14408422 CACTGCCACCCAAGGAAAGTTGG - Intronic
1171212560 20:23328003-23328025 CAGTGCAACGCAAGGGAAGAGGG + Intergenic
1171852970 20:30321664-30321686 AAAGGTGACTCAAGGGAAGTGGG + Intergenic
1173405741 20:42762920-42762942 CAAAGTAAGCCAAGGGAAGTTGG - Intronic
1174680602 20:52403116-52403138 CAGTGTAACCCAACGTACGTAGG + Intergenic
1175604320 20:60299734-60299756 CTATGTGACCCCAGGGAGGTTGG + Intergenic
1175608076 20:60327853-60327875 GGCTGTGACCCAAGGAAAGTGGG - Intergenic
1176061765 20:63175673-63175695 TAGGGTGACCCAAGGGAAGGGGG + Intergenic
1179023405 21:37659314-37659336 AGGTGTGACCCAAGGGAGGCAGG + Intronic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1182396238 22:30038410-30038432 CAAGGTGAGCCAAGGCAAGTGGG + Intergenic
1182744341 22:32594130-32594152 CAGTGGGAGACAAGGGAATTGGG + Intronic
1184604505 22:45564455-45564477 CAGCGTGGCTCAAGGGAAGTGGG - Intronic
949168476 3:969470-969492 CTGTGTGACCCAGGGCAAGTCGG - Intergenic
949880049 3:8654495-8654517 CAGTGTAACTGCAGGGAAGTAGG - Intronic
950447328 3:13045797-13045819 CAGGGTGGCCCCAGGGAAGGAGG - Intronic
953297535 3:41735423-41735445 AAGGGTGACCCAGGGGAATTGGG - Intronic
954174625 3:48834265-48834287 CAGTGTGAACCAAGCAAAGGAGG + Intronic
954661832 3:52230559-52230581 CAGTGTGACCCCAGGGGTATGGG + Intronic
956487862 3:69740531-69740553 AAGGGTGGCTCAAGGGAAGTGGG - Intronic
957967299 3:87338895-87338917 CTGTGTGACCCAAGGCAAATTGG - Intergenic
960017532 3:112909215-112909237 CAGTATGAACCACTGGAAGTGGG - Intergenic
960504528 3:118477006-118477028 CATTAAAACCCAAGGGAAGTAGG + Intergenic
964427795 3:156571406-156571428 CTGTGTGGACCAAAGGAAGTAGG + Intergenic
965516083 3:169622474-169622496 GCGTGTGACCCAAAGTAAGTGGG - Intronic
967819179 3:193825611-193825633 CGGTGTGACTCGAGGGAACTCGG - Intergenic
967943704 3:194786035-194786057 CAGTGTGGCCCCAGGAAATTTGG + Intergenic
968047270 3:195631360-195631382 CAGCCTCACCCAAGGGCAGTTGG + Intergenic
968307343 3:197658564-197658586 CAGCCTCACCCAAGGGCAGTTGG - Intergenic
970240074 4:13999865-13999887 CAGTGTGCTCCAAGGTGAGTTGG + Intergenic
972396250 4:38662221-38662243 AAGTGTGACCCAAGATAAGAAGG - Intergenic
976637677 4:87303418-87303440 CAGTGTGACCTCTGGGAAATGGG + Intergenic
978131875 4:105208231-105208253 CAAGGTGACCCAAGATAAGTTGG - Intronic
978291995 4:107152554-107152576 CAGTGTGAAGAAGGGGAAGTTGG + Intronic
981252257 4:142617375-142617397 CCCTGTGACCTAAGGGAAGGTGG - Intronic
981586671 4:146310877-146310899 CAGTGTGAAACAGGGGAAGGGGG + Intronic
984051100 4:174866304-174866326 CAGGGTGACACAAAGGATGTAGG - Intronic
984105686 4:175542189-175542211 CAGTGTAAACCAAGGAATGTAGG + Intergenic
988233574 5:28509450-28509472 GAGTGTGACCCATGAGAAGGTGG - Intergenic
990042265 5:51389326-51389348 AAGTGTTAGCCAAGGGAAGCAGG - Intronic
990165609 5:52989911-52989933 CTGTCTGAGCCAGGGGAAGTTGG - Intronic
990986820 5:61648467-61648489 CAGAGTGAACAAAGGAAAGTAGG + Intronic
991054254 5:62305469-62305491 AACTGTGACTCAAGGGAAGAAGG - Intergenic
991093103 5:62711782-62711804 CAGAGTGTCCACAGGGAAGTGGG + Intergenic
993090615 5:83421637-83421659 CAATGCGACCCAAGTGAAGGGGG - Intergenic
993137319 5:83985901-83985923 CAGAATGACCCAAAGCAAGTTGG - Intronic
999121737 5:149215024-149215046 CAGTTTGAGCAAAGGGAGGTAGG - Intronic
1000243949 5:159433563-159433585 GAGTGTGACCTTAGGGAAGAAGG + Intergenic
1002428832 5:179191529-179191551 CAGTGTGACCTAAGGAAAGAGGG + Intronic
1002654747 5:180736586-180736608 CAAGGAGACCCAAGGGATGTAGG + Intergenic
1003619484 6:7685383-7685405 CAGTGTAAACCAAGGGTGGTTGG - Intergenic
1003915358 6:10781849-10781871 CAGAGTGAGACATGGGAAGTGGG - Intronic
1004814093 6:19293886-19293908 CAGGGTGACCTGAGGAAAGTGGG - Intergenic
1007160971 6:39791908-39791930 CAGTGTGTCCCAAGGGGTGCTGG - Intergenic
1007253342 6:40511446-40511468 CATTGTTATCCACGGGAAGTAGG + Intronic
1008405988 6:51119177-51119199 CAATGGAACCAAAGGGAAGTAGG - Intergenic
1008628220 6:53338304-53338326 CAGTGTGACCCAAGGGAAGTTGG - Intronic
1010863055 6:80937519-80937541 CTGTGTCACCCCAGGGAAGTGGG + Intergenic
1011085712 6:83538136-83538158 AAATGTGTCCCAAGGAAAGTCGG - Intergenic
1012527175 6:100192124-100192146 CTGTGGCACCCAAGGGATGTTGG + Intergenic
1012711570 6:102613568-102613590 CAGTGTGAGGCAGGAGAAGTGGG + Intergenic
1015218769 6:130780624-130780646 CAGTGTGACCTATAGGAAGATGG + Intergenic
1016510013 6:144831790-144831812 CAGTGTCACCCAAGGGCAGATGG - Intronic
1017083677 6:150693543-150693565 CAGTGTGACCAAAGAGAGGGTGG - Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1021720473 7:23499833-23499855 CAGTGTGACAGAAGGGATCTAGG - Intergenic
1023185271 7:37526571-37526593 CAGTGTGACCAAAAGGAATCTGG - Intergenic
1029239068 7:99145654-99145676 GTGTGTGTCCCAAGGAAAGTAGG + Intergenic
1030110057 7:106019340-106019362 CATTGCTACCCAAGGAAAGTTGG + Intronic
1031501237 7:122519690-122519712 CAGTGTGACCTAAGGATAGCTGG - Intronic
1031667246 7:124499701-124499723 AAGTTTGACAGAAGGGAAGTGGG + Intergenic
1034501852 7:151455826-151455848 CAGTGTACCCCACGGCAAGTGGG + Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1036679420 8:10860157-10860179 CCGTGTTAGCCAAGGGAAGAGGG - Intergenic
1040060629 8:43100284-43100306 CAGTGTGTGCTTAGGGAAGTGGG + Intronic
1042363726 8:67912083-67912105 CAGTGTGAACCCAGAGGAGTGGG - Intergenic
1043449002 8:80348236-80348258 CAGTATGCCCCAAGGAAAGATGG - Intergenic
1044021741 8:87113202-87113224 CAGTGTGAGCCATGGGCAGTAGG + Intronic
1047752282 8:127890902-127890924 TAGGGAGACCCAAAGGAAGTTGG - Intergenic
1048509405 8:135048794-135048816 CAGTGTGCCCCAGGGGAGATAGG - Intergenic
1049207602 8:141370718-141370740 CAGTGGGAACCAAGGAAACTGGG + Intergenic
1049303505 8:141884405-141884427 CAGTGCCTCCCAGGGGAAGTGGG - Intergenic
1051319009 9:15879566-15879588 TAGTATGGCCCAAGAGAAGTTGG - Intronic
1051858917 9:21601684-21601706 CAGTGTGACCCACGGTATCTGGG + Intergenic
1053283927 9:36838577-36838599 CAGTTTCCCACAAGGGAAGTTGG + Exonic
1054884172 9:70178007-70178029 CAGTGTAACCCCAGGGCTGTAGG + Intronic
1055826041 9:80325982-80326004 CTGTGTTACCAATGGGAAGTGGG - Intergenic
1056460403 9:86804464-86804486 AAATGTGACTGAAGGGAAGTTGG - Intergenic
1056683536 9:88740980-88741002 CAGTGTGAGTGAAGGGCAGTGGG + Intergenic
1057546695 9:96024315-96024337 CAGAGTGAATGAAGGGAAGTAGG + Intergenic
1058178843 9:101771206-101771228 CAGTGTGTCAGAAGGGGAGTAGG - Intergenic
1061330023 9:129886334-129886356 CAGTGTGGCACAAGGGAACAAGG - Intergenic
1061807972 9:133147111-133147133 CAGTGTGGCCCAAGTGAGCTGGG - Intronic
1062608916 9:137364098-137364120 CAGTGATGCCTAAGGGAAGTAGG - Intronic
1185568562 X:1115185-1115207 GAGTGTGACCCAAGTGTAGCTGG + Intergenic
1187148285 X:16657431-16657453 CAGGGTGACCAAAGTGAACTGGG + Intronic
1192268472 X:69556468-69556490 CAGAGAAACCCAGGGGAAGTGGG + Intergenic
1193901892 X:87189755-87189777 CAGGGTGAAACAAGGAAAGTTGG + Intergenic
1196017343 X:110954047-110954069 CAGTGAGATCAAGGGGAAGTGGG - Intronic
1200060051 X:153480152-153480174 CAGTGTGTCCCAAGGGTGGGGGG - Intronic
1200683145 Y:6236326-6236348 AAGTGTGGCCAAATGGAAGTGGG - Intergenic
1201049487 Y:9918060-9918082 AAGTGTGGCCAAATGGAAGTGGG + Intergenic