ID: 1008629241

View in Genome Browser
Species Human (GRCh38)
Location 6:53348218-53348240
Sequence CCCTCCGAGGGGCGGACGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008629234_1008629241 -7 Left 1008629234 6:53348202-53348224 CCGAGCTAGCAGGCTTCCCTCCG 0: 1
1: 0
2: 2
3: 3
4: 93
Right 1008629241 6:53348218-53348240 CCCTCCGAGGGGCGGACGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 93
1008629230_1008629241 27 Left 1008629230 6:53348168-53348190 CCGTTGTCTGGTTTCAATAAAAA 0: 1
1: 0
2: 4
3: 27
4: 349
Right 1008629241 6:53348218-53348240 CCCTCCGAGGGGCGGACGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 93
1008629233_1008629241 -6 Left 1008629233 6:53348201-53348223 CCCGAGCTAGCAGGCTTCCCTCC 0: 1
1: 0
2: 1
3: 7
4: 156
Right 1008629241 6:53348218-53348240 CCCTCCGAGGGGCGGACGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008629241 Original CRISPR CCCTCCGAGGGGCGGACGGA AGG Intronic
911444260 1:97970964-97970986 CCCTGCGGGGGGCGGCCGGGGGG + Intergenic
915224716 1:154404114-154404136 CCCTCCAAGGGACGGACAGATGG + Intergenic
919830742 1:201538898-201538920 CCCGCAGAGGGGCGGAGGCATGG - Intergenic
920363567 1:205436114-205436136 CCATCTGAGGGGCGGGAGGAAGG - Intronic
921190036 1:212700312-212700334 CGCGCCGGGGGGCGGACGCAGGG - Intergenic
922462592 1:225824708-225824730 CCCACCCTGGGGAGGACGGAGGG - Intronic
1071086797 10:81875150-81875172 CCCCCCGAGAGGCGGGCGGCGGG - Intergenic
1072811970 10:98468912-98468934 CCCTCAGAGGGTAGGATGGAGGG - Intronic
1084597950 11:70128442-70128464 CCCTCCAAGGGAAGGAAGGAAGG - Intronic
1091154764 11:133362383-133362405 GCCTCCGAGGGGAGGCGGGAAGG - Intronic
1092228947 12:6766456-6766478 CCGTCCGGAGGGCGGGCGGAAGG - Exonic
1094375318 12:29783386-29783408 CGGTCCGAGGGACGGGCGGAGGG + Intronic
1094621046 12:32080556-32080578 GTCTCCGAGTGGCAGACGGAAGG + Intergenic
1103433098 12:120904345-120904367 CCCGCCGAGGGGAGGAGGGGCGG + Exonic
1103597210 12:122030979-122031001 CCCTCAGAGCGGTGGACGGGGGG + Intronic
1104845657 12:131845488-131845510 CCCTCCATGAGGCGGACAGAGGG - Intronic
1105418481 13:20232598-20232620 CCCTCCAAGGGCCGGAAAGAGGG - Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1112506026 13:99975941-99975963 CCCTCCCAGGGGCTCTCGGAGGG + Intergenic
1113437743 13:110306840-110306862 ACCCCCGAGGGGCAGGCGGACGG + Intronic
1113493807 13:110713073-110713095 TCCTCCGGGAGGCGGAAGGAAGG - Intronic
1117315203 14:54566320-54566342 CCCGCCGAGGGCCGTAGGGAGGG - Intergenic
1118220763 14:63853126-63853148 CCCTCGGCCGGGCGGACGGTGGG + Exonic
1122293883 14:100694238-100694260 GGCTCCGAGGGGTGGGCGGAAGG - Intergenic
1125536270 15:40442255-40442277 CACTCCGAGGGGCGGGCGACGGG + Intronic
1125718809 15:41835407-41835429 CCCTCCCTGGGGCAGAAGGAAGG - Intronic
1131558282 15:93418021-93418043 CCCTCCCAGGGGCAGAAGGAAGG + Intergenic
1133224973 16:4336733-4336755 CCCTCGTAGGGGCAGACGTAGGG - Exonic
1137614493 16:49838690-49838712 GACTCCGAGGGGCGGGCGGCCGG + Intronic
1139583117 16:67884835-67884857 CCCTCCGGGGGCTGGGCGGACGG + Exonic
1140224113 16:73065117-73065139 CCCTGCGATGGGCGGGCGGCGGG + Intergenic
1141150033 16:81558178-81558200 TCCTCTGATGGACGGACGGATGG - Intronic
1141421929 16:83923096-83923118 CCCTCAGAGGGAAGGAGGGATGG - Exonic
1141557739 16:84846930-84846952 CCCTCCTGGGGGCTGACGGCTGG + Intronic
1144366433 17:14549303-14549325 TCTTCCGAGGGTCGGACCGAGGG - Intergenic
1144711497 17:17404315-17404337 CCCTCTGATGGGAGGAGGGAAGG + Intergenic
1145250888 17:21296484-21296506 CCCTCCCTGAGGCGGAAGGAGGG - Intronic
1147188350 17:38724996-38725018 CCCTCAGAGGGGAGGCAGGAAGG - Intronic
1147965542 17:44192553-44192575 CCCTCCGAGAGGAGGCCAGAGGG - Exonic
1152654366 17:81513058-81513080 CCCTCCGAGGGTCGCCGGGAGGG + Intronic
1160007051 18:75075431-75075453 CCCTTCGTGGGGAGGATGGAGGG + Intergenic
1163686494 19:18714850-18714872 CCCTCCAAAGGGCTGAGGGAGGG - Intronic
1165333795 19:35155409-35155431 CCCTGCCAGGGGCTGACGGCTGG - Exonic
1165428206 19:35757064-35757086 CCCTCCGAGGGGCCGGCACAGGG - Intronic
1166155071 19:40904933-40904955 CCTTCCAAGGGGCCCACGGAAGG + Intergenic
1166367426 19:42284538-42284560 CCCCGCGTGGGGCGGCCGGAGGG + Intronic
1166733505 19:45071423-45071445 CCCTCCGTGGGGTGGACGGCTGG - Intergenic
1167662520 19:50804303-50804325 TCCGCCGCGGGGCAGACGGAGGG + Intronic
1168458980 19:56538571-56538593 CCCGCAGAGGGCAGGACGGACGG + Intergenic
926957452 2:18317073-18317095 CCCTCCAAGGGGCTGACAGTGGG - Intronic
929966710 2:46542504-46542526 CCCTGCGAGGGCCGCGCGGAGGG - Intronic
932591552 2:73070876-73070898 CCCTCCGAGGGGCTGCCGCCTGG - Intronic
942453294 2:176121930-176121952 CCCTCGGAAGGGCGGGCGGCCGG - Intergenic
944413261 2:199462250-199462272 CCCTCCTGGGGGCGGGAGGAGGG + Intronic
948454154 2:238097001-238097023 CCCTAGGAGGGGCAGAGGGAGGG + Intronic
1168991928 20:2102794-2102816 GCGTCCCAGGGCCGGACGGAGGG + Exonic
1172320943 20:33994475-33994497 CCCGGCGAGGGGCGGAGGGAGGG + Intronic
1179495399 21:41768267-41768289 CCCTCCAAAGAGCGGCCGGATGG - Intergenic
1179820491 21:43934295-43934317 ACCTCCCAAGGGCGGAAGGAGGG + Intronic
1180068227 21:45423491-45423513 CCCTCCGGGGGGCGGGGGGCGGG - Intronic
1180177790 21:46098622-46098644 CTCTCCCCGGGCCGGACGGAAGG + Intronic
1180342203 22:11628241-11628263 GCCTCCGCGGTGGGGACGGAGGG + Intergenic
1183022443 22:35038263-35038285 CCCTCCCAGTGGCTGAGGGATGG + Intergenic
1183679132 22:39316894-39316916 CCCTCCGAGGGGTGAGCGGAAGG + Intronic
1184769671 22:46589865-46589887 CTCTCTGAGGGGCTGAGGGAGGG - Intronic
1185254322 22:49823912-49823934 GCCTCCTGGGGGCGGACGGAGGG + Exonic
1185292788 22:50035476-50035498 CCCTCCCAGGGAAGGACTGAAGG + Intronic
950263444 3:11558621-11558643 CCCTGCGAGAGGCGGACTCAGGG + Exonic
952929228 3:38346814-38346836 CACGCCGCGTGGCGGACGGACGG + Exonic
953741515 3:45542947-45542969 CCCACCTAGGGGCTGAGGGAGGG + Intronic
954661144 3:52227555-52227577 CCCTCTGAGAGGTGGATGGAGGG - Intergenic
954670756 3:52290229-52290251 CCCTCAGAGGGGCGGCCGTGGGG + Intronic
961637759 3:128343760-128343782 GCCTCCGAAGGGCTGAGGGAGGG + Intronic
968591792 4:1463241-1463263 CCCTCTGAGAGCCGGAGGGAAGG - Intergenic
969604962 4:8197775-8197797 GCCTCAGTGGGGCGGAGGGAGGG + Intronic
976380923 4:84397602-84397624 CCCTCAGAGGGGCAGATGCATGG - Intergenic
985950184 5:3217131-3217153 CACTCGGAAGGGCGGAGGGATGG - Intergenic
990955193 5:61332980-61333002 CCCACCCAGGGACTGACGGACGG - Intronic
995841439 5:116446810-116446832 CCCTCTGCGGGGCGGGCGGCGGG + Exonic
1001470168 5:172006404-172006426 CCCGCCCGGGGCCGGACGGACGG + Intronic
1003137515 6:3444961-3444983 CCCACCAAGGGGAGGAAGGAAGG + Intronic
1004013082 6:11708119-11708141 CCCTTGGAGGGGTGGACAGAGGG - Intergenic
1007656601 6:43454838-43454860 CCCCAGGAGGGACGGACGGATGG + Exonic
1008629241 6:53348218-53348240 CCCTCCGAGGGGCGGACGGAAGG + Intronic
1017073847 6:150600160-150600182 CCCTCCGCAGTGGGGACGGAGGG + Intronic
1019378903 7:711474-711496 TCCTCCGAGGGGCAGGCGGGCGG + Exonic
1026858514 7:73770138-73770160 CGCCCCGACGGACGGACGGACGG + Exonic
1029736744 7:102469453-102469475 CCCTCCGAGGCGGGGAGGGCGGG - Intronic
1033043229 7:137937400-137937422 CCCTGCAAGGGGAGGAGGGAGGG - Intronic
1034470774 7:151253302-151253324 TACTCTGAGGGGAGGACGGAGGG - Intronic
1034530485 7:151693306-151693328 CCCTCCGAGGGGCGCACGAGGGG + Intronic
1044692480 8:94894767-94894789 CCCTCCGAGCGGCGGTAGGGCGG - Intronic
1049442605 8:142616147-142616169 CCCCCCCAGGGGCGGAAGGAAGG - Intergenic
1059061403 9:111038271-111038293 ACTGCCGAGGGGCGGGCGGAGGG - Intronic
1059308138 9:113370567-113370589 CCCTCAGAGGGGCAGATGCATGG - Exonic
1060770272 9:126327091-126327113 CCGGCCGAGGGGCGGGCGGACGG + Intronic
1060965838 9:127711961-127711983 CCCACGGAGGGGCGGGCGGCGGG + Intronic
1061727460 9:132589569-132589591 CCCTCAGAAAGGCGGGCGGAAGG - Exonic
1062085689 9:134646869-134646891 GCCTCTGAGGGGCTGTCGGATGG + Intronic
1062431229 9:136527700-136527722 CCCTAAGAGGGACGCACGGAAGG - Intronic
1062606576 9:137351227-137351249 CCCTCCCCGGGGCACACGGAGGG + Intronic
1062614131 9:137388345-137388367 CCGGCCGACGGGAGGACGGATGG + Intronic
1190149921 X:47936817-47936839 CTCTCCGGGGGGCGGGGGGAGGG + Intronic