ID: 1008632441

View in Genome Browser
Species Human (GRCh38)
Location 6:53375567-53375589
Sequence TTTCCTTCTTCAGGTCTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008632441_1008632446 20 Left 1008632441 6:53375567-53375589 CCATTGAGACCTGAAGAAGGAAA No data
Right 1008632446 6:53375610-53375632 CAAGCTGTAATGCTTAGAACAGG No data
1008632441_1008632447 25 Left 1008632441 6:53375567-53375589 CCATTGAGACCTGAAGAAGGAAA No data
Right 1008632447 6:53375615-53375637 TGTAATGCTTAGAACAGGATAGG No data
1008632441_1008632444 -4 Left 1008632441 6:53375567-53375589 CCATTGAGACCTGAAGAAGGAAA No data
Right 1008632444 6:53375586-53375608 GAAAAGAATATAGTTATTTAGGG No data
1008632441_1008632445 -3 Left 1008632441 6:53375567-53375589 CCATTGAGACCTGAAGAAGGAAA No data
Right 1008632445 6:53375587-53375609 AAAAGAATATAGTTATTTAGGGG No data
1008632441_1008632443 -5 Left 1008632441 6:53375567-53375589 CCATTGAGACCTGAAGAAGGAAA No data
Right 1008632443 6:53375585-53375607 GGAAAAGAATATAGTTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008632441 Original CRISPR TTTCCTTCTTCAGGTCTCAA TGG (reversed) Intergenic
No off target data available for this crispr