ID: 1008632446

View in Genome Browser
Species Human (GRCh38)
Location 6:53375610-53375632
Sequence CAAGCTGTAATGCTTAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008632441_1008632446 20 Left 1008632441 6:53375567-53375589 CCATTGAGACCTGAAGAAGGAAA No data
Right 1008632446 6:53375610-53375632 CAAGCTGTAATGCTTAGAACAGG No data
1008632442_1008632446 11 Left 1008632442 6:53375576-53375598 CCTGAAGAAGGAAAAGAATATAG No data
Right 1008632446 6:53375610-53375632 CAAGCTGTAATGCTTAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008632446 Original CRISPR CAAGCTGTAATGCTTAGAAC AGG Intergenic
No off target data available for this crispr