ID: 1008645983

View in Genome Browser
Species Human (GRCh38)
Location 6:53515453-53515475
Sequence GCTATGTGCAGAGCCTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008645983_1008645988 -1 Left 1008645983 6:53515453-53515475 CCCCAAAAGGCTCTGCACATAGC 0: 1
1: 0
2: 1
3: 14
4: 156
Right 1008645988 6:53515475-53515497 CAAACGTGAGGGCCTGTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008645983 Original CRISPR GCTATGTGCAGAGCCTTTTG GGG (reversed) Intronic
901917029 1:12507797-12507819 GCTGGCTGCAGAGCCTCTTGCGG + Intronic
902704190 1:18193106-18193128 GCTGTGTCCAGGGGCTTTTGAGG + Intronic
902718033 1:18286104-18286126 GAAATGTGCAGAGGCTTTTGGGG - Intronic
904463667 1:30695161-30695183 GCCATGTTCAGAGCCCTTTCTGG + Intergenic
910041099 1:82852222-82852244 GCAATGAGCAGAGCCTTGAGGGG + Intergenic
910579268 1:88803936-88803958 GCTATTTGCAGAACTTTTTCTGG + Intronic
910667736 1:89742550-89742572 GCAATGGACAGAGCCATTTGAGG + Intronic
911460592 1:98184582-98184604 GCTCTTTGGAGAGGCTTTTGAGG + Intergenic
912658076 1:111505416-111505438 GGTATGTGCAGAGAATTCTGAGG - Intronic
912860693 1:113211320-113211342 GTAAGCTGCAGAGCCTTTTGGGG + Intergenic
912951471 1:114123498-114123520 ACAAAGTGCAAAGCCTTTTGGGG + Intronic
913324581 1:117615602-117615624 GCCATGTGAAGAGCCCTTGGAGG + Intronic
914240369 1:145849100-145849122 ACTATGTCTAGAGCCTCTTGGGG - Exonic
915317471 1:155037235-155037257 GCTGAGTGCAGAGCCTCATGAGG - Intronic
915460298 1:156066519-156066541 GCCAAGTGCAGAGCATTGTGCGG - Intronic
915617519 1:157050914-157050936 GAGAGGTGCAGAGCTTTTTGAGG + Intergenic
916067297 1:161146533-161146555 GGTATGTGCAGCACCTTCTGTGG - Intergenic
923848773 1:237769002-237769024 GCATTGTGCAGAGCATTTTTAGG + Intronic
923996369 1:239499639-239499661 CCTAAGTGAAGATCCTTTTGCGG - Intronic
924375032 1:243398109-243398131 GCAGTGTGCAGAAACTTTTGTGG - Intronic
1063178372 10:3572188-3572210 GTTACATGCAGAGCCTTTTAAGG - Intergenic
1063313066 10:4973524-4973546 GACATGTGCAAAGCCTTTTCAGG + Intronic
1063314928 10:4994524-4994546 GACATGTGCAAAGCCTTTTTAGG - Intronic
1063548005 10:7000874-7000896 GGTAATTTCAGAGCCTTTTGTGG + Intergenic
1070671458 10:78380394-78380416 GGTCTGCGCAGAGCCTTTGGGGG - Intergenic
1070930945 10:80260228-80260250 CCACTGTGCACAGCCTTTTGGGG - Intergenic
1072153475 10:92702292-92702314 GCTATGTTCAGAGTCCCTTGTGG - Intergenic
1076642689 10:131929543-131929565 GCGATGTGGAGAGCCTATGGCGG - Intronic
1078548946 11:12267319-12267341 GCTAAGGGCAGAGCCTGTTTTGG - Intergenic
1079482847 11:20900266-20900288 GAAATGTGCATGGCCTTTTGAGG + Intronic
1081720129 11:45282810-45282832 GCTATCTACAGACCCTTTGGTGG + Intronic
1082119334 11:48361450-48361472 GATGTGGGCAGAGCCTTTGGTGG + Intergenic
1083057484 11:59836923-59836945 ACTATGTGCAAAGCATTTTGTGG - Intronic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1089863635 11:121612743-121612765 GCTATGTGGTGAACCTTTTCTGG + Exonic
1090996257 11:131868476-131868498 GCTCTGTGCAGACCCTTCAGTGG + Intronic
1091225094 11:133952226-133952248 CCCATGGGCAGCGCCTTTTGGGG + Intronic
1092831610 12:12449422-12449444 GCCATTTGCAAGGCCTTTTGTGG + Intronic
1093608818 12:21128819-21128841 GGAATGTGCAGAGCCCTGTGGGG + Intronic
1096212622 12:49778174-49778196 GGAATGTGCAGAGCAGTTTGAGG - Intergenic
1098631490 12:72728150-72728172 GCCATGTGCAGATTGTTTTGTGG + Intergenic
1099929547 12:89057913-89057935 CCTATGTGCAAAGCCTTTTGTGG + Intergenic
1101428053 12:104604041-104604063 GGTGTGTGCTTAGCCTTTTGTGG + Intronic
1101488618 12:105191623-105191645 CCTATGTTCAGAGTCTTTGGTGG - Intronic
1102663437 12:114549261-114549283 GCTGGGTCCAGGGCCTTTTGTGG + Intergenic
1105015711 12:132785835-132785857 GCTCTGAGCAGAGCCTTCCGTGG - Intronic
1113211264 13:107984240-107984262 TCTAAGTGCAGAGCCTTATGTGG - Intergenic
1116899489 14:50348218-50348240 GCTACTTCCCGAGCCTTTTGAGG - Intronic
1118805883 14:69236600-69236622 GCCATATGCAGAGCCTTTGGGGG + Intronic
1119620189 14:76126057-76126079 GCTTTGTGCAGAGGGCTTTGGGG - Intergenic
1119879391 14:78088350-78088372 GCTATGAGCAGAGCCCTTCTGGG + Intergenic
1126206917 15:46056473-46056495 GCTATTTTCAGATCCATTTGGGG + Intergenic
1126228872 15:46302277-46302299 GCTCAGTGCAGAGCATTCTGTGG - Intergenic
1126364837 15:47883454-47883476 GCTATGTGCAGGCCCTTCTCAGG + Intergenic
1128826949 15:70727903-70727925 GCTCTGTGAAGAGCCTTAGGTGG - Intronic
1129174414 15:73829778-73829800 GCTATGGGAAGATGCTTTTGAGG + Intergenic
1129661705 15:77556410-77556432 GCTGTGTGCAGAGCCTGGAGGGG - Intergenic
1130447926 15:84021399-84021421 TCTTTCTGCAGAGCCTTTTTGGG + Exonic
1130528232 15:84725207-84725229 GGAATGCCCAGAGCCTTTTGGGG - Intergenic
1131690416 15:94821084-94821106 GCTATGTTCACAACATTTTGAGG + Intergenic
1131928464 15:97413068-97413090 GCTATGTCCAGAGCTCTGTGAGG + Intergenic
1133296302 16:4754148-4754170 ACCATGCGCAGAGCCTCTTGCGG - Intronic
1133430107 16:5729353-5729375 GCTGTGTGCTGAGCTTATTGAGG - Intergenic
1135262290 16:20991079-20991101 GCTCTGTCGAGAGGCTTTTGTGG - Intronic
1137579172 16:49622894-49622916 GCTATGTGCAGTGTCTTCTATGG + Intronic
1141026607 16:80554678-80554700 GCTATTTGCAGAGTCTCTGGAGG + Intergenic
1141617066 16:85215951-85215973 GCTGTGAGCAGAGCCCTTGGAGG + Intergenic
1143873340 17:9973694-9973716 TCTGGGTGCAGTGCCTTTTGCGG - Intronic
1145102907 17:20091544-20091566 GCAATGTGCAGAGGCATTTACGG - Intronic
1150644766 17:66971158-66971180 GCTATGGGCAGAGGCTTTCCGGG - Intronic
1151074155 17:71251829-71251851 GCTATGCATAGAGCGTTTTGTGG - Intergenic
1153791828 18:8586168-8586190 GATTTGTGCAGAGACTTTTTAGG + Intergenic
1157271949 18:46283038-46283060 TTTAGGTCCAGAGCCTTTTGTGG - Intergenic
1159963042 18:74570368-74570390 GATCTGGGCAGAGCCTTTGGTGG + Intronic
1161725659 19:5927068-5927090 GCTGTGTCTAGAGACTTTTGTGG - Intronic
1165004601 19:32794529-32794551 GCAATGTGTAGTGCTTTTTGGGG + Intronic
1165819108 19:38663343-38663365 GCTCTGTGCCGAGCCTTTAGGGG + Intronic
1167090743 19:47341949-47341971 GCTATGTGCAAGGCCTTTTTAGG + Exonic
925921768 2:8643381-8643403 GCTATGTGCAGAGTCAAGTGAGG - Intergenic
928728650 2:34205698-34205720 TCTATGTTCAGGGCCTTATGTGG + Intergenic
930864145 2:56106187-56106209 GCTGTGTGCAGAGCCTTATCTGG + Intergenic
932892369 2:75608280-75608302 GCTATATGCAAAGCATTTTGAGG - Intergenic
941651205 2:168094404-168094426 GGGATGTGCAGAGGCTTCTGAGG - Intronic
942404809 2:175642962-175642984 GCTATGTGCAGATTTTTGTGTGG + Intergenic
942561870 2:177228330-177228352 GCTAGGCGCAGTGCTTTTTGTGG + Intronic
942923387 2:181404469-181404491 GCTTTGTGCTGTGCCTTCTGTGG + Intergenic
943015222 2:182502108-182502130 GCTATTTGAAGAGGCATTTGAGG - Intronic
945029727 2:205652063-205652085 TCCATGTGTACAGCCTTTTGAGG + Intergenic
946783665 2:223219982-223220004 GCTCTGATCAGATCCTTTTGAGG + Intergenic
947058237 2:226132512-226132534 GGTGTTTGCAGAGTCTTTTGTGG + Intergenic
948452769 2:238087367-238087389 CCTATGTGTAGAGCTGTTTGTGG - Intronic
1173561109 20:44006320-44006342 TCTGTGTGCAGAGCCTCTGGTGG + Intronic
1176442872 21:6792038-6792060 GCTATGTGATGTGCCTTGTGTGG + Intergenic
1176821027 21:13657040-13657062 GCTATGTGATGTGCCTTGTGTGG + Intergenic
1178722833 21:35025463-35025485 GCCACGTGCATAGCCTGTTGGGG - Intronic
949910441 3:8901271-8901293 TCTATGTTTAGAACCTTTTGAGG - Intronic
950433685 3:12966456-12966478 GCTATCTGCAGGCCCTTCTGAGG - Intronic
950868235 3:16206860-16206882 GCTATTGGCAAAGCATTTTGTGG - Intronic
952405694 3:33003059-33003081 GTCAGCTGCAGAGCCTTTTGGGG - Intronic
954990945 3:54840260-54840282 GCAATGTGCAGAGCTCTTTATGG + Intronic
957351602 3:79030232-79030254 GCAATGTCCAGAGACATTTGTGG + Intronic
959577948 3:107955066-107955088 GGTTTTTGCAGAGTCTTTTGTGG - Intergenic
961334458 3:126162451-126162473 GCTATTTGGATATCCTTTTGTGG + Intronic
961558288 3:127711516-127711538 GCAATGTGCACAGACATTTGGGG + Intronic
961633678 3:128319527-128319549 GCTTTGTGCAAAGTCTGTTGAGG - Intronic
962310924 3:134326326-134326348 GCATTGAGCAGCGCCTTTTGAGG + Intergenic
965447017 3:168786809-168786831 TCTATGTGCAGATTCTTCTGTGG - Intergenic
965788979 3:172367299-172367321 ACTATGTGCTGGGCCTTATGAGG + Intronic
974078706 4:57191528-57191550 CCTGTGTGCAGTTCCTTTTGTGG - Intergenic
974184513 4:58429620-58429642 GCTTTGTGCAGGGCCTTTATTGG + Intergenic
975989673 4:80244867-80244889 GGTTTGTGGAGAGCTTTTTGAGG + Intergenic
978197953 4:105992164-105992186 TTTATGTGCAGATCCATTTGAGG + Intronic
982102116 4:151978215-151978237 GTGATGTGCAGAGCTTTTGGTGG - Intergenic
985224056 4:187740080-187740102 GCTATGTGCTGTGTGTTTTGTGG - Intergenic
985256694 4:188077048-188077070 GATGTGGGCAGAGCCTTTGGTGG + Intergenic
985371396 4:189289183-189289205 GATGTGGGCAGAGCCTTTGGTGG - Intergenic
986822511 5:11482937-11482959 GGCATGTGTGGAGCCTTTTGGGG + Intronic
989120280 5:37998033-37998055 GATTTGTGCGGAGCATTTTGGGG + Intergenic
995222312 5:109663665-109663687 GATATGGGCAGAGCAATTTGGGG - Intergenic
995322684 5:110854981-110855003 CCTCTGTGCTGAGGCTTTTGAGG + Intergenic
996346919 5:122497657-122497679 GCCATGTGAAAAGCCTTTTCTGG + Intergenic
997581977 5:135023865-135023887 ACTATGTGCAGACACTTCTGAGG + Intergenic
997778707 5:136635467-136635489 GCTTTGGGCAGAGACTTTTGGGG + Intergenic
999421954 5:151452117-151452139 GCTTTGTGCAGAACCTGCTGAGG + Intronic
1002007280 5:176245924-176245946 GGTTTTTGCAGAGCCTTTTGTGG + Intronic
1002219099 5:177664698-177664720 GGTTTTTGCAGAGCCTTTTGTGG - Intergenic
1002442747 5:179272865-179272887 GCTGTGTGGAGAGCCCTCTGAGG - Intronic
1003259027 6:4499712-4499734 GATCAGTGGAGAGCCTTTTGTGG - Intergenic
1005649285 6:27871851-27871873 GCTCTGAAAAGAGCCTTTTGGGG + Intergenic
1005856422 6:29866535-29866557 GAGGTGTGCAGAGCCTTGTGGGG - Intergenic
1006067382 6:31471766-31471788 GGGGTGTGCAGAGCCTTGTGGGG + Intergenic
1006285783 6:33092768-33092790 GCTATAGGCAGTGCCATTTGTGG + Intergenic
1006285801 6:33092879-33092901 GCTATAGGCAGTGCCATTTGTGG + Intergenic
1007198537 6:40085050-40085072 GCTATGTGCAGTGGCTTTCCGGG - Intergenic
1008645983 6:53515453-53515475 GCTATGTGCAGAGCCTTTTGGGG - Intronic
1009374123 6:62946671-62946693 GTTATGTGCATATCCATTTGAGG - Intergenic
1011888651 6:92128857-92128879 GCCATTTGAAGAGTCTTTTGAGG + Intergenic
1015562590 6:134532790-134532812 GCTATGTGGAGAGGTTCTTGTGG + Intergenic
1018508856 6:164503432-164503454 GCTATGTGCAGATTATTTTGTGG + Intergenic
1019444642 7:1065019-1065041 GCTTTCTGCAGAGCCCCTTGGGG + Intronic
1022674033 7:32481661-32481683 ACTCTGTTTAGAGCCTTTTGGGG - Intergenic
1024007143 7:45233092-45233114 GGTTTTTGCAGAGTCTTTTGTGG + Intergenic
1024877234 7:54039598-54039620 ACTATGTGCAGATCCATTAGAGG + Intergenic
1024889077 7:54180620-54180642 GCTCTGTGGAGAGCCTCTAGAGG - Intergenic
1028172490 7:87615233-87615255 ACTCTGTGTAGAGGCTTTTGGGG - Intronic
1029865514 7:103623766-103623788 ACTGTGTGCAGATCCTTCTGGGG + Intronic
1030734792 7:113034882-113034904 GATAAATGCAGAGCCTTTTAAGG + Intergenic
1034119708 7:148616343-148616365 GGCATGGGCAGAGCCTTCTGAGG + Intergenic
1037432633 8:18829927-18829949 GGTATCTTCAGAGCTTTTTGGGG - Intronic
1037811966 8:22091908-22091930 ACTATGTGCTGAGCCCATTGAGG + Intronic
1038423003 8:27445561-27445583 ACTGTGTGCAGAGCATCTTGGGG + Intronic
1039611619 8:38923804-38923826 TGTATTTGCAGAGCATTTTGTGG + Intronic
1040387274 8:46922039-46922061 CCTCTGTGCAGAGACCTTTGGGG + Intergenic
1041128121 8:54666333-54666355 GCTCTGTGCTAAGCCTTATGTGG + Intergenic
1042689493 8:71482251-71482273 GCCATTTGAATAGCCTTTTGTGG - Intronic
1046561218 8:115839945-115839967 GCTAGGTACAGCCCCTTTTGAGG + Intergenic
1046627540 8:116590983-116591005 GATTTGGGCAGAGCCTTTGGTGG + Intergenic
1047318794 8:123759312-123759334 GCTATGTCCAGAGACATTTTTGG - Intergenic
1047326336 8:123840004-123840026 CCTTTGTGCAGATCGTTTTGAGG + Intergenic
1048443578 8:134477410-134477432 GCTCTGTGCACAGCATTGTGGGG - Intergenic
1055213360 9:73827457-73827479 GATGTGTACAGATCCTTTTGTGG + Intergenic
1058689516 9:107507566-107507588 GCTCTGTTCAGAACCTGTTGAGG + Intergenic
1059123925 9:111665639-111665661 GATAGGTGCAGAGACTCTTGAGG + Intronic
1060124226 9:121026612-121026634 GCAATGTCCAGAGACATTTGTGG - Intronic
1062278702 9:135742534-135742556 TCCATGTGCAGAGCCATGTGGGG - Intronic
1062335049 9:136061302-136061324 GCCATGGGCAGAGCCTGCTGTGG - Intronic
1203769914 EBV:44525-44547 GCTATGCGCCGAGGCCTTTGAGG + Intergenic
1203526332 Un_GL000213v1:92495-92517 GCTATGTGATGTGCCTTGTGTGG - Intergenic
1189901501 X:45711640-45711662 ATTATGTGCAAAGCCTTTTGGGG + Intergenic
1196940507 X:120771338-120771360 GCATTGTACAGAACCTTTTGGGG + Intergenic
1198624820 X:138559087-138559109 GCTGTGTGCACTGCCTTTTGTGG + Intergenic
1199305476 X:146262835-146262857 GCTCTGATCAGAGCCTTATGTGG + Intergenic