ID: 1008646939

View in Genome Browser
Species Human (GRCh38)
Location 6:53524120-53524142
Sequence TTAAATAAGCATAATGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 708
Summary {0: 1, 1: 0, 2: 3, 3: 73, 4: 631}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008646939 Original CRISPR TTAAATAAGCATAATGAGAA AGG Intronic
900007996 1:77432-77454 TTAAATAAGCATACTTAAAATGG + Intergenic
900700828 1:4047773-4047795 TTAATTAATCATAATTAGGAAGG - Intergenic
904102964 1:28049099-28049121 TTAAATATTCATAATTTGAATGG - Intronic
904174719 1:28618772-28618794 ATAAATATGCACAATGATAAAGG - Intronic
905026048 1:34850260-34850282 TTAAATCTGAATAATTAGAAGGG + Intronic
906308143 1:44734321-44734343 TGAAATAAGCATAATGGGCTAGG - Intergenic
906331805 1:44891527-44891549 TTAAATAAGTGTAAGGAGATGGG - Intronic
907532378 1:55113864-55113886 TTAAATAAGAGTGATGAGAGAGG - Intronic
907535209 1:55146814-55146836 TTATATAAGCATAAATAGTATGG - Intronic
907942692 1:59104771-59104793 GTAAATAACTATAAGGAGAAGGG - Intergenic
908645231 1:66271203-66271225 TGAAATAACCATAATAAGCAGGG - Intronic
908708388 1:66987627-66987649 TTTAATAAGCATATTCAGAATGG - Intronic
908885346 1:68781923-68781945 TTTATTAAGCAGCATGAGAACGG + Intergenic
909078791 1:71084769-71084791 TATAATAAGAATAAAGAGAATGG - Intergenic
909509277 1:76432952-76432974 AGAAATCAACATAATGAGAATGG - Intronic
909680990 1:78291975-78291997 TTAAATAATAAAAATGAAAATGG - Intergenic
909735600 1:78957310-78957332 ATAATTAAGCATAGTGAGGAAGG + Intronic
910015983 1:82524517-82524539 TTAAAGAAGCCAAATGAAAAAGG + Intergenic
910660778 1:89670084-89670106 TTAAATAAGGGGAATGGGAAAGG - Intronic
911013452 1:93306277-93306299 AAAAATCAGCCTAATGAGAAAGG + Intergenic
911251435 1:95580955-95580977 TTAAATATGCATCTTAAGAAAGG + Intergenic
911763257 1:101641034-101641056 TGAAAGCAGTATAATGAGAATGG - Intergenic
911768672 1:101711268-101711290 TAAAATAAGAAAGATGAGAAGGG - Intergenic
913110374 1:115652132-115652154 CTAAATAAGCCTCATGACAAAGG - Intronic
913315459 1:117547337-117547359 TTAAAGCAGAATGATGAGAATGG + Intergenic
915006543 1:152643338-152643360 ATAATTAAGCTGAATGAGAAAGG - Intergenic
915199810 1:154219113-154219135 CTAAAGAAGCAGAATGAGAGTGG + Intronic
915811460 1:158917041-158917063 TTAAATATTCATCATGAGATCGG + Intergenic
915871711 1:159567377-159567399 TTAAATAGGAATGATGAGAGGGG - Intergenic
916541855 1:165764526-165764548 TTTACTAAACAAAATGAGAAGGG + Intronic
917361640 1:174182853-174182875 TTAAATAGCCATACTGAGAAAGG - Intronic
918625944 1:186656128-186656150 TCACATAAGCATAAAGAGGAGGG - Intergenic
919022734 1:192128686-192128708 TTAAATAATGTCAATGAGAAAGG + Intergenic
919101532 1:193103051-193103073 TTAAATAATAATAATAATAATGG + Intronic
919270156 1:195331265-195331287 TTGAATTAGCATAATTGGAAGGG + Intergenic
919357433 1:196542126-196542148 TTAAAAAACCATGATGTGAAAGG + Intronic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
921087278 1:211806895-211806917 TTAAATAAGAGTGATGAGAGTGG - Intronic
921271155 1:213471389-213471411 ATAAATAAGCATATTAATAATGG - Intergenic
921518555 1:216129294-216129316 TTAAAAAAGCAAAAACAGAATGG - Intronic
921680413 1:218024388-218024410 TTAAATTAGCATAATATGACTGG - Intergenic
922307698 1:224358222-224358244 CTAGATATGCACAATGAGAATGG + Intronic
923346074 1:233053829-233053851 CAAAATAATAATAATGAGAATGG - Intronic
924027398 1:239849251-239849273 GTAAATATGCAAAATCAGAATGG - Intronic
924462716 1:244273752-244273774 TTAAATCAGAAAAATGAAAACGG - Intergenic
924506219 1:244687233-244687255 TTTAATAAGGAGAATGAAAAGGG - Intronic
924704282 1:246487044-246487066 TTAAATAAGAACAGTCAGAATGG + Intronic
1062980057 10:1714583-1714605 TTAAATAAGAAACATAAGAAGGG - Intronic
1063023152 10:2149411-2149433 TTAAAAAAACACAATGAGATAGG + Intergenic
1063910379 10:10823128-10823150 TTAAAAAATCACAATTAGAAAGG + Intergenic
1065178083 10:23097709-23097731 TCAAATAAGGATAATGATAATGG + Intronic
1066162596 10:32750152-32750174 TTTAAAAAGCAAGATGAGAAAGG - Intronic
1066984977 10:42456817-42456839 TAAAAGAAGAATAATGATAAAGG + Intergenic
1068268962 10:54694879-54694901 ATAAATAAGCTTAGTGAGAAAGG + Intronic
1068324412 10:55465499-55465521 TTAAATAAGACTGATGAAAAGGG - Intronic
1068357935 10:55935554-55935576 CTATATTAGCCTAATGAGAAAGG + Intergenic
1068697998 10:59989703-59989725 TTACATATGGACAATGAGAAAGG - Intergenic
1068802940 10:61162577-61162599 TTATATAAGCAAGATGGGAATGG - Intergenic
1069754788 10:70767237-70767259 TTATTTAAGCAAAAAGAGAAAGG + Intergenic
1070392732 10:75985306-75985328 TTAAATTAGCATAAGCAAAAAGG + Intronic
1070905978 10:80073502-80073524 TTGAAACAGTATAATGAGAATGG - Intergenic
1071323898 10:84492505-84492527 TTGAATAAGAATTATGAGAATGG + Intronic
1071425926 10:85551140-85551162 TTGAATAGGGATAGTGAGAAAGG - Intergenic
1071577560 10:86740533-86740555 TTAAACAAGCAGAAGGAAAAAGG - Intergenic
1073958643 10:108900982-108901004 TTAAATAGGCACAATCACAAAGG + Intergenic
1076105197 10:127816661-127816683 TTAAACAAGGAAAATGTGAATGG + Intergenic
1076272984 10:129171900-129171922 AAAAATAAGAATAATGAGAGAGG - Intergenic
1076309192 10:129491957-129491979 TTTAATAATAATAAAGAGAAGGG - Intronic
1076577659 10:131480829-131480851 TTAAATAGGGATGATGAGAAAGG + Intergenic
1077747301 11:4920804-4920826 TAAAATATTCAAAATGAGAAGGG + Intronic
1077786081 11:5384752-5384774 TAAAATAAGCAGATTGAGGATGG - Intronic
1078363599 11:10689055-10689077 TTAAATAAAAGTAATGACAATGG - Intronic
1079499023 11:21081284-21081306 TTAAAAAAGGGTAATTAGAAAGG - Intronic
1079514771 11:21254428-21254450 TAAATTAAGTATCATGAGAAAGG + Intronic
1079557890 11:21783622-21783644 TTAAATGAGTATAATGATACAGG - Intergenic
1080889861 11:36400120-36400142 TTAAATAAGCAGAGGGAAAAAGG + Intronic
1081094142 11:38910996-38911018 GTGATTAAGCTTAATGAGAAAGG + Intergenic
1081205829 11:40274526-40274548 TTTGATAAGCATAATGAAAAGGG + Intronic
1081240187 11:40695852-40695874 TAAATTAAGAATATTGAGAAGGG - Intronic
1081338942 11:41903530-41903552 TTAACAACGCATCATGAGAATGG - Intergenic
1082018126 11:47508018-47508040 TTAAATGGTCATAATGATAAAGG - Intronic
1083230897 11:61318226-61318248 CTGAATAAATATAATGAGAAGGG - Intronic
1085901545 11:80705977-80705999 TTGAATAAGCATAGTGAGAGTGG - Intergenic
1086517919 11:87635353-87635375 TTAAATAAGAAAAGAGAGAAGGG + Intergenic
1086560181 11:88158871-88158893 TTCAATAGGCACAATGAGAATGG - Intronic
1086745429 11:90420638-90420660 TAAAATAAGCACATGGAGAATGG + Intergenic
1086775130 11:90821222-90821244 ATAATTAAGCTTAGTGAGAAGGG - Intergenic
1087174663 11:95085621-95085643 CTTAATAGGCATAATTAGAAGGG + Intergenic
1087289602 11:96305532-96305554 TTGAATAATAATAATGAGACAGG + Intronic
1087619153 11:100522569-100522591 TTACAAAACCATCATGAGAATGG + Intergenic
1088022772 11:105139638-105139660 TTCACAAAGCCTAATGAGAAAGG + Intronic
1088211320 11:107459835-107459857 ATAAACAAGAATAAAGAGAAAGG + Intergenic
1088254837 11:107893697-107893719 TTACTTAAGAATAATGAAAAGGG + Intronic
1088806866 11:113360531-113360553 TTGAATAAGAAAACTGAGAAAGG + Intronic
1089236883 11:117036388-117036410 TTCTATAAGCACAATCAGAATGG - Intronic
1090237524 11:125160316-125160338 TTAAATAAGCACTATAATAAAGG + Intergenic
1090604202 11:128404644-128404666 TGTGATAAGCATCATGAGAAAGG + Intergenic
1091161742 11:133428890-133428912 TTAAGGAAGAATAATAAGAAAGG + Intronic
1091669724 12:2444387-2444409 ATAAATTCGCATAATGTGAAGGG + Intronic
1093624073 12:21325803-21325825 TTAACAAAGAATAATGAGAAAGG - Intronic
1093677011 12:21954322-21954344 TTGAATAGGAATAATGAGAGTGG + Intergenic
1095238784 12:39832422-39832444 TTCAAAAAGCATAATGATAAAGG + Intronic
1095283077 12:40379558-40379580 CTAAAAAGGCACAATGAGAATGG + Intergenic
1095333418 12:40996968-40996990 TTCAATCAGCATAATGAGGCTGG - Intronic
1097355786 12:58599953-58599975 TTAAATAATCTTAATGACCACGG - Intronic
1097667017 12:62490746-62490768 TTATATAAGAATAATCAAAAAGG - Intronic
1097740476 12:63235997-63236019 TTAAAAAAGCATCCTAAGAAAGG + Intergenic
1097934538 12:65230790-65230812 TTAAATAAGAATGGTGAGAATGG + Intronic
1098126414 12:67298755-67298777 TTAAATAAGTACAATTTGAAAGG + Intronic
1098460246 12:70725122-70725144 TAAAATAAGCATGAAGAGACAGG + Intronic
1098677768 12:73312681-73312703 TCAAATAAGCACAATGACAAAGG - Intergenic
1098751347 12:74296922-74296944 TAAAATAAGCTTAATAACAAAGG - Intergenic
1099598121 12:84694731-84694753 TAAAAGAAGCATATTGAGAGAGG - Intergenic
1099637514 12:85233292-85233314 CTAGATAAGCAGAAGGAGAATGG + Intronic
1099744188 12:86681040-86681062 TTAAATAAAAATTATGAGAAAGG + Intronic
1099801696 12:87465101-87465123 TTAAATACACAGAATGACAAAGG + Intergenic
1100670287 12:96804242-96804264 TTAAATAAGAATGGTGAAAATGG - Intronic
1100761972 12:97817666-97817688 TTAAATAATAATAATGAACAAGG + Intergenic
1101294845 12:103411289-103411311 TTAAAAAATCATAATCAAAAGGG + Intronic
1101677603 12:106932686-106932708 ATGATGAAGCATAATGAGAAAGG + Intergenic
1102367848 12:112354943-112354965 TTAAATAAGCATAAGGTTAAGGG + Intronic
1104802819 12:131566311-131566333 TAAAATAAACAGAATGAAAATGG - Intergenic
1105572182 13:21613030-21613052 GAAAATAAGCCTGATGAGAATGG - Intergenic
1106014974 13:25860335-25860357 ATAAATAATAATAATGAGGAAGG - Intronic
1106094616 13:26632209-26632231 TTGAATAAGCATGGTGAGAGAGG + Intronic
1107171789 13:37351098-37351120 TTAAATAAGGATTATCAAAAAGG + Intergenic
1108257696 13:48626739-48626761 TTAAATAAGCAAAATGCCAGGGG + Intergenic
1108522997 13:51261659-51261681 CTAAATAAGCTAAGTGAGAAAGG - Intronic
1108706109 13:52989255-52989277 TTAAAACACCAAAATGAGAAAGG - Intergenic
1108845059 13:54668167-54668189 ATAAATAAGAATAGTGAGGAAGG - Intergenic
1109637548 13:65142607-65142629 TTAAAAAAGCAAAAAGTGAAAGG - Intergenic
1109647609 13:65279783-65279805 ATAAATAAGCATCAAGATAATGG - Intergenic
1109836758 13:67868889-67868911 TTTAAAAAGAATAAAGAGAAAGG - Intergenic
1109893475 13:68651054-68651076 ATAATTAAGCTTAGTGAGAAAGG + Intergenic
1110141139 13:72131002-72131024 TAGAATAAGCATAATAAGGAAGG + Intergenic
1110379003 13:74828051-74828073 ATAATTAAGCTTAATGAGGAAGG + Intergenic
1110829064 13:80009609-80009631 AAAAAAAAGCATAAGGAGAAGGG + Intergenic
1111049616 13:82863552-82863574 TTTAATAAGCGTCATTAGAAAGG - Intergenic
1111278044 13:85978092-85978114 TGATATAAGAATAAAGAGAAAGG + Intergenic
1111304570 13:86390481-86390503 ATAAATAAAAATAAGGAGAAAGG + Intergenic
1111538974 13:89646699-89646721 TTAAGTAATCATAATGGGTAAGG - Intergenic
1112081325 13:95974783-95974805 TTAAATATTAATAATGAGACTGG + Intronic
1113332221 13:109340638-109340660 TTAAGTTAACATGATGAGAATGG - Intergenic
1113576310 13:111397590-111397612 TTAAATAACCCATATGAGAAAGG - Intergenic
1113595840 13:111531144-111531166 TTAAATAACAATAAGGAGATTGG + Intergenic
1114133161 14:19816732-19816754 TTGAATAAGGATGGTGAGAAAGG + Intronic
1114155098 14:20093543-20093565 GGAAATAAACATACTGAGAAAGG - Intergenic
1115530610 14:34323551-34323573 TCAAATAAGCATCATGATAAAGG + Intronic
1115775641 14:36711899-36711921 TTAGAAAAACATAATTAGAAAGG - Intronic
1115885456 14:37966780-37966802 TTTGATAAACATAATCAGAAAGG - Intronic
1115926469 14:38441332-38441354 TTAAATAACCATAAAAGGAACGG - Intergenic
1116041316 14:39689554-39689576 TTAAATAAATAGAAAGAGAAAGG + Intergenic
1116101240 14:40439607-40439629 ATAATTAAGCTTAGTGAGAAGGG - Intergenic
1116300735 14:43178810-43178832 TATAAGAAGCATAATAAGAATGG + Intergenic
1116526426 14:45911069-45911091 TTAAATATCCATTATGAGAATGG - Intergenic
1117260337 14:54026226-54026248 TTAAATAATAATAATAATAATGG + Intergenic
1117885310 14:60355239-60355261 ATTAATAAGCATAATAATAATGG + Intergenic
1118959927 14:70519778-70519800 ATGATTAAGCTTAATGAGAAAGG + Intergenic
1119874281 14:78044034-78044056 TTAAATAAATAGCATGAGAAGGG - Intergenic
1120052151 14:79879254-79879276 TGAAATAAGTACCATGAGAAAGG + Intergenic
1120724062 14:87917704-87917726 ATAAAGAAGTATAATGAGAAAGG - Intronic
1121706644 14:96001362-96001384 TTAAATAAGCATGGTGAGGAGGG - Intergenic
1121766583 14:96492631-96492653 ATAATTAAGCATAGTGAGGAAGG - Intergenic
1123988720 15:25667622-25667644 TGCAACAAGCATAATGTGAATGG - Intergenic
1125014322 15:34916303-34916325 TTAAGTGAGAATAATGAAAAGGG - Intronic
1126197231 15:45945702-45945724 ATAAAAAAGTATAATGATAAAGG + Intergenic
1126281731 15:46959931-46959953 TTAAATAATAGTAATGACAATGG - Intergenic
1126393855 15:48190803-48190825 TAAAATAAGGATAAAGAGCAAGG + Intergenic
1126718059 15:51543383-51543405 TTCCATATGCAAAATGAGAAGGG - Intronic
1126911165 15:53418689-53418711 TTAAATAATAATAATAATAAAGG + Intergenic
1127176117 15:56359787-56359809 TTAAATAATAATGATGATAAAGG + Intronic
1127300877 15:57652288-57652310 TTTAATAAGCATGAAGAAAATGG - Intronic
1127760304 15:62132895-62132917 TTAAATGAGCATTAAGAGAGAGG + Intergenic
1128586165 15:68852410-68852432 TAAAATAAACATGAAGAGAAAGG + Intronic
1128722593 15:69961734-69961756 ATGATTAAGCATAGTGAGAAAGG + Intergenic
1128782764 15:70373894-70373916 TTAAAAAAGCAAAAGAAGAAAGG + Intergenic
1128845176 15:70887388-70887410 TTTATTAAGCAATATGAGAAAGG + Intronic
1129963987 15:79717005-79717027 TTAAAAAAACACAATGGGAAAGG + Intergenic
1131256812 15:90868434-90868456 ATAAATGAGGAAAATGAGAAGGG + Intergenic
1131627234 15:94134307-94134329 TTATATAAACATTATGTGAATGG + Intergenic
1131690212 15:94819043-94819065 GTGAATAAAAATAATGAGAAAGG - Intergenic
1131713747 15:95085501-95085523 TAAGAAAAGCATAATTAGAAAGG + Intergenic
1131933864 15:97479369-97479391 TTGAATAAGAATGGTGAGAATGG + Intergenic
1132044684 15:98553621-98553643 TTAATGGAGCATAATAAGAAGGG + Intergenic
1132445561 15:101914678-101914700 TTAAATAAGCATACTTAAAATGG - Intergenic
1133465604 16:6024334-6024356 TTTCATAAGGATAATGAAAAGGG + Intronic
1133512726 16:6475605-6475627 TTAATGAAGCATATTGAGATGGG - Intronic
1133611069 16:7433810-7433832 TTAAATAAGTATTTTTAGAAAGG - Intronic
1133611517 16:7438158-7438180 TTATATAAGAAAAATCAGAATGG + Intronic
1134341368 16:13349858-13349880 TTAAATAAGCAAAAAGACCAAGG + Intergenic
1134373730 16:13650233-13650255 TTACATAAGCAAAATGAGGTGGG + Intergenic
1134386251 16:13775778-13775800 TTAACTAAGCCTGATGAGAGTGG - Intergenic
1136129954 16:28213391-28213413 TTGAATAGGAATGATGAGAAAGG + Intergenic
1136524420 16:30819646-30819668 TTGAATAAGAATAATAAGAATGG + Intergenic
1137333535 16:47525862-47525884 TTATAAAAGCATAATGAGGAAGG + Intronic
1137937598 16:52649470-52649492 TCAAATATGCAAAATTAGAAAGG + Intergenic
1139116798 16:63963901-63963923 TTAAATAAGCTTAACTTGAATGG - Intergenic
1139646022 16:68330988-68331010 TCAAATATCCATAATGAAAATGG - Intronic
1140546855 16:75818394-75818416 TTTAATAAGAAAACTGAGAAGGG - Intergenic
1140588168 16:76319440-76319462 TTAAATTAGCATACTTCGAATGG - Intronic
1141250933 16:82358473-82358495 TTAAATAAGGATCTTGAGATGGG + Intergenic
1141277889 16:82604653-82604675 GTAAAAAAGCAAAAGGAGAAAGG + Intergenic
1143074569 17:4329797-4329819 TTAAAAAAGCCTAATGGCAATGG - Intronic
1143969224 17:10781896-10781918 TTAAAAAATTAAAATGAGAAAGG - Intergenic
1146097979 17:29950942-29950964 TTAAATAAGTGTAAAAAGAAAGG - Intronic
1146118713 17:30169148-30169170 TAGAATAAGCAGACTGAGAAAGG - Intronic
1148203124 17:45763036-45763058 TAAAAAAAGAATAATGACAATGG - Intergenic
1148434358 17:47670913-47670935 TCATAGAAGCATAATGAGACAGG + Intronic
1149252554 17:54787065-54787087 TTAAAATACCAAAATGAGAAAGG + Intergenic
1149941688 17:60876372-60876394 TTAAAACATCATAAAGAGAAGGG - Intronic
1150415337 17:64983678-64983700 TAAAATAATCATAACAAGAAAGG - Intergenic
1150796327 17:68240359-68240381 TAAAATAATCATAACAAGAAAGG + Intergenic
1150826905 17:68484577-68484599 TTAAATAAGAGTGATGAGAGTGG + Intergenic
1150866108 17:68852134-68852156 TTAAATGAGGATTAGGAGAATGG - Intergenic
1150969780 17:70014547-70014569 GTAAATAAGTATATTGTGAAAGG - Intergenic
1153320377 18:3767875-3767897 TTGAATAAGCATGATAAGAGTGG - Intronic
1153990274 18:10391840-10391862 TTAACTAAGCCTAAAGAAAATGG + Intergenic
1154459185 18:14562601-14562623 TGAAATAAGAATGGTGAGAAAGG + Intergenic
1154967006 18:21369041-21369063 TTTAAAAAGTATAGTGAGAAAGG - Intronic
1155336574 18:24771228-24771250 TTAAATAAGGAAAATAAAAATGG - Intergenic
1155562754 18:27097348-27097370 TTGAATAGGCATAGTGAGAATGG - Intronic
1155652092 18:28154662-28154684 ATGAAAAAGAATAATGAGAACGG - Intronic
1155853716 18:30805408-30805430 ATGATTAAGCTTAATGAGAAAGG + Intergenic
1155998275 18:32356103-32356125 TTTAAGGAGCAAAATGAGAAAGG + Intronic
1156037006 18:32775492-32775514 TTAAAAAAGAATATTGATAAAGG + Intergenic
1156424446 18:36994686-36994708 TAAAATAAGCAGAATGAGTCAGG - Intronic
1156650524 18:39221062-39221084 TTGAAAAAGAATAATGAGAATGG - Intergenic
1156686842 18:39660186-39660208 TAAAATAATAATGATGAGAATGG + Intergenic
1157019891 18:43768078-43768100 TTAAATAGGAGTAATGAGAAAGG + Intergenic
1157352872 18:46906144-46906166 TTAAATTAGCAAACTAAGAAAGG + Intronic
1157494679 18:48147907-48147929 TTAAAAAAGCATAATCAGCCAGG - Intronic
1158428514 18:57361614-57361636 TGAAATAAAGAAAATGAGAATGG - Exonic
1158931324 18:62326768-62326790 TTAAACATGCATAATGAAAGGGG - Intronic
1159148795 18:64492820-64492842 TTAAATAAGATTAAAAAGAAAGG + Intergenic
1159173072 18:64797926-64797948 ATGAATAAGCTTAATGAGGAAGG + Intergenic
1159295727 18:66485247-66485269 TAAAATTAAAATAATGAGAATGG - Intergenic
1160078303 18:75699443-75699465 ATAAATAATCGTAATGAGAATGG + Intergenic
1160454331 18:78988367-78988389 TTTAATCATCATCATGAGAAGGG + Intronic
1160639751 19:119027-119049 TTAAATAAGCATACTTAAAATGG + Intergenic
1161717600 19:5885748-5885770 TTTAGAAAGCATACTGAGAAAGG + Intronic
1163903063 19:20124821-20124843 TTAAATAGGAATACTGTGAATGG - Intronic
1163946088 19:20536281-20536303 CTAAATAAGAATATTGTGAATGG + Intronic
1163953232 19:20610746-20610768 CTAAATAAGAATATTGTGAATGG + Intronic
1164135224 19:22408396-22408418 TTCAATAAGAATGGTGAGAAAGG - Intronic
1164471539 19:28540012-28540034 TTGAATAAGAATAATGAGAGTGG - Intergenic
1164928948 19:32158072-32158094 ATAAATAAACAGCATGAGAAAGG - Intergenic
1165235050 19:34414156-34414178 TTAAATAATAATAATAATAAAGG - Intronic
1166285009 19:41820226-41820248 TTGAATAAGGATGATGAGAGTGG + Intergenic
1167515516 19:49921205-49921227 ATAAATGAGCAAACTGAGAAAGG + Intronic
1168338917 19:55612924-55612946 TAAAATGAGCATAATGATAAGGG - Intronic
1168541420 19:57214271-57214293 TTGAATAGGAATAGTGAGAAAGG + Exonic
925453619 2:3993791-3993813 TTAAATAGGAGTGATGAGAAGGG + Intergenic
925945796 2:8862271-8862293 TTAAATAAAGATGATCAGAATGG - Intronic
925985988 2:9215346-9215368 GTAAAGAAGCATTATGAGCATGG - Intronic
926617205 2:15008676-15008698 TTAAATAAGTTTAAGGAGAGTGG - Intergenic
927732910 2:25491101-25491123 TTAAGAAAGCAAACTGAGAAGGG + Intronic
927745613 2:25617395-25617417 TTAAGTATGCATCCTGAGAATGG + Intronic
928704460 2:33933070-33933092 TAAAAGAATCATAATGATAAAGG - Intergenic
928794168 2:34996460-34996482 TTAAAAACCCATAATGATAAAGG - Intergenic
930507369 2:52300756-52300778 TAAAAAAAGCATACTGAGCAGGG + Intergenic
930624126 2:53677695-53677717 TTTACTAAACATAATGATAAAGG - Intronic
931577118 2:63729964-63729986 TTATTTACGCATAGTGAGAATGG + Intronic
932717626 2:74113399-74113421 TTGAATAAGAGTAATGAGAGTGG - Intergenic
933148610 2:78887921-78887943 AGAGATAAGCACAATGAGAAAGG + Intergenic
933292337 2:80451923-80451945 TAAGATAAGCATAAAGAGGAGGG + Intronic
933331087 2:80894007-80894029 TTCATTAAGAATAATGAAAAGGG + Intergenic
934101976 2:88661746-88661768 TTTAATAGGCAGAATTAGAAAGG - Intergenic
934589417 2:95532613-95532635 ATAAATAAAAATAAAGAGAAAGG + Intergenic
935116405 2:100140554-100140576 TAAAATAAGCATAATTGCAATGG + Intronic
935228347 2:101074072-101074094 ATGATTAAGCTTAATGAGAAAGG - Intronic
936835113 2:116700195-116700217 TTAAATATACTTAATGAGGAAGG + Intergenic
936886238 2:117313178-117313200 TTAAATAAACCTAGTCAGAATGG + Intergenic
937109948 2:119357686-119357708 TTGAATAAGAATGGTGAGAATGG - Intronic
937191212 2:120100948-120100970 TTAAATAATCATATTGAGATGGG + Intronic
937502730 2:122498995-122499017 CTCAATAACCATAATGAAAAAGG - Intergenic
937946332 2:127341295-127341317 TTTATTAAGAAAAATGAGAACGG + Intronic
938725332 2:134103763-134103785 TAAAATAACCATAATGATCATGG - Intergenic
939434718 2:142160482-142160504 TCAAATAAACACAATCAGAAAGG + Intergenic
939543334 2:143520314-143520336 TTATAAAAGCATAATAAAAATGG + Intronic
939655815 2:144823235-144823257 TTAAATAAAAATAGTGAGAGTGG - Intergenic
939921832 2:148125405-148125427 TTAAATATACATTATGAAAATGG + Intronic
939937097 2:148306000-148306022 TTAAATAAGCATGGCAAGAATGG + Intronic
939953633 2:148505628-148505650 TTAAATAAGAATAAGGAAATAGG + Intronic
940024739 2:149193999-149194021 TTAAATAAGCAGAGAGAGATGGG - Intronic
940184796 2:150972060-150972082 ATAATTAAGCTTAGTGAGAAAGG - Intergenic
940264391 2:151820998-151821020 TTAGATAAACATGATGAAAAAGG + Intronic
941062679 2:160865595-160865617 TAAAATAAAAATAAAGAGAATGG + Intergenic
941130396 2:161641434-161641456 TTAAATCAGCATTATGAGCAAGG - Intronic
941210701 2:162634915-162634937 TTACAAAAGAATAAAGAGAACGG - Intronic
941538560 2:166753574-166753596 TTAAATAAGGATTCTGAGAATGG - Intergenic
942405932 2:175655030-175655052 TTGAATAGGAATAGTGAGAAAGG - Intergenic
942789032 2:179737240-179737262 ATAAATAAGCATCATCAAAAAGG - Intronic
942833175 2:180261316-180261338 ATAATTAAGCTTAGTGAGAAAGG - Intergenic
942839494 2:180342043-180342065 TTAAATAAACATAGTTAAAAAGG - Intergenic
943184141 2:184584672-184584694 GTAGATAATTATAATGAGAAGGG - Intergenic
943202294 2:184843756-184843778 TTAAATATACATAATCAGATAGG - Intronic
943265762 2:185729908-185729930 TTAAAAAATCATGAGGAGAAAGG + Intergenic
944112276 2:196145372-196145394 TGAAAGAAGGATAAGGAGAAAGG + Intronic
944233278 2:197417329-197417351 GTAAATATGCATAGTGATAATGG + Intronic
944308387 2:198203955-198203977 TAAAATATGCAGAATGAGAAGGG + Intronic
944507739 2:200430221-200430243 TTCAATAGAGATAATGAGAAAGG - Intronic
944967856 2:204956093-204956115 TTAAATAAGCCCAAAGAGCATGG - Intronic
945791081 2:214306413-214306435 TTGAATAGGCATAGTGAGAGAGG + Intronic
945843480 2:214915658-214915680 TTAAATGAGCTTAATGTGGAAGG + Intergenic
946220860 2:218225483-218225505 TTTAATATGCTTAAAGAGAAAGG - Intronic
946645442 2:221828449-221828471 ATAACTAAGCTTAATGAGGAAGG - Intergenic
1169079615 20:2788622-2788644 GTAAATAAGCAAAATGCAAAAGG - Intergenic
1169215146 20:3789232-3789254 TCAAATAAACAAAAGGAGAATGG - Intronic
1169555622 20:6746212-6746234 TTAAATCAGAATAATAAAAATGG - Intergenic
1169943365 20:10962095-10962117 ATAAATAATAATAAAGAGAAAGG - Intergenic
1170154247 20:13255098-13255120 TTAAATAAGCAGAATGATAGAGG + Intronic
1170280577 20:14642492-14642514 ATAATTAAGCCTAGTGAGAAAGG - Intronic
1170489834 20:16861821-16861843 TTAAGTAAGCTGGATGAGAAAGG + Intergenic
1170592422 20:17780981-17781003 TTAAATAAGTAAAATGAAACAGG - Intergenic
1170772452 20:19344937-19344959 TCAAATAAGAATGATGAGAACGG - Intronic
1171124775 20:22592005-22592027 TTAAATAAGCATTAAGGGAATGG - Intergenic
1171430062 20:25077533-25077555 TTAATTAAAAATAATAAGAACGG + Intronic
1171792425 20:29539444-29539466 TGAAAAAAGTATAATGTGAATGG - Intergenic
1172833142 20:37853761-37853783 TAAAATAAGCAGAATGATTATGG - Intronic
1173332788 20:42089071-42089093 TTAACCAAGCATAGTGAGAAAGG + Intronic
1174978534 20:55363466-55363488 GCATATAAGCATCATGAGAATGG - Intergenic
1176814955 21:13590744-13590766 TTGAATAAGAATGGTGAGAAAGG - Intergenic
1177290265 21:19102528-19102550 TTAAAAAAGAAAAATGACAATGG + Intergenic
1177391341 21:20477042-20477064 ATAATTAAGCTTAGTGAGAAAGG + Intergenic
1177392386 21:20493155-20493177 TTTAATAACAATGATGAGAATGG + Intergenic
1178100519 21:29263873-29263895 ATTAATAAGCTTAGTGAGAAAGG - Intronic
1178250357 21:30998112-30998134 CTAAATGAGCCTAATGAGATGGG + Intergenic
1178377883 21:32083226-32083248 TTAAATAAACATTCTGAGCAAGG + Intergenic
1178679117 21:34657416-34657438 ATAAATAAGGCTAAAGAGAAAGG - Intergenic
1180741730 22:18057797-18057819 TCAAATGAGCATCATGAGCAAGG + Intergenic
1181695343 22:24590123-24590145 ATAAATAAGCAAAAAAAGAAGGG - Intronic
1181723297 22:24793048-24793070 TGAAAGAAGCAAAATGCGAAGGG + Intergenic
1182058165 22:27377574-27377596 TTAACTCTGCATAATGATAAAGG + Intergenic
1182367769 22:29790306-29790328 TCAAATAAGGATAGTGATAATGG + Intronic
1182393297 22:30017654-30017676 AGAAATAACTATAATGAGAAAGG + Intronic
1182822376 22:33228305-33228327 TTAAATCATTATAATGAAAACGG + Intronic
1183031165 22:35106253-35106275 TAAAACAAGAATAATGAGGAAGG - Intergenic
1184157794 22:42679912-42679934 TAAAATAATAATAATGAGATGGG - Intergenic
949243510 3:1898354-1898376 TCACAAAACCATAATGAGAAGGG + Intergenic
949388590 3:3534229-3534251 TTAAATAAAAGTGATGAGAAGGG + Intergenic
949513119 3:4783731-4783753 TTAAATACCCAACATGAGAAAGG + Intronic
951309258 3:21104252-21104274 TTAAATCAACAAAATTAGAAAGG - Intergenic
951421781 3:22494868-22494890 TTATATCAGCAGAATGAGACTGG - Intergenic
952764577 3:36943859-36943881 TTTAAGAAGCAGAAAGAGAATGG - Intronic
953079919 3:39607506-39607528 TTAAATAGCCATTATAAGAAAGG - Intergenic
953659217 3:44879173-44879195 ATAAATCAGAATGATGAGAAAGG - Intronic
953735459 3:45490433-45490455 TTCAATAAGTAGAAGGAGAATGG + Intronic
953868485 3:46605478-46605500 TCAAATAGGCATATTGAAAAGGG - Intronic
953868488 3:46605513-46605535 TCAAATAGGCATATTGAAAAGGG - Intronic
954490223 3:50897519-50897541 TTAAATAGGCATGGTGAGAGAGG + Intronic
954543014 3:51408213-51408235 TTATTTAAGCATAAGGACAAAGG + Intronic
955580145 3:60410816-60410838 TTAAATAAGCAATATGAGAATGG - Intronic
956715590 3:72076990-72077012 TTAAATAATAATAATAATAATGG - Intergenic
956754896 3:72375251-72375273 TTAAAAAAGTAGACTGAGAATGG + Exonic
956920061 3:73918758-73918780 GTAAATAAGTAGATTGAGAATGG - Intergenic
957043367 3:75354401-75354423 AGAAACCAGCATAATGAGAAAGG + Intergenic
957698827 3:83682416-83682438 AGAAATAAGAATAATTAGAAAGG - Intergenic
957832486 3:85540966-85540988 TTAAATAAGTAAAAAAAGAAAGG - Intronic
957843879 3:85705166-85705188 TTAAATAAGAATGAAAAGAAGGG - Intronic
957843979 3:85706827-85706849 TTAAATAAGAATAAAGAAAAAGG + Intronic
957963961 3:87297736-87297758 TAAAATAAAAATAATTAGAATGG - Intergenic
958679151 3:97304281-97304303 TTGAATAAGAGTAGTGAGAAAGG + Intronic
958723362 3:97873856-97873878 TCAATTAATCATAATGAGATAGG + Exonic
958930295 3:100200374-100200396 TCAAATAAGCAAAATGAAAAAGG + Intergenic
959221444 3:103525737-103525759 ATAAATGAGGATAATGAAAAGGG + Intergenic
959569279 3:107866021-107866043 TTAAATAACCATGATTAAAATGG - Intergenic
959622296 3:108411492-108411514 TTAAGTGAGCATAATGAGATGGG - Intronic
959637640 3:108592786-108592808 ATAAATAAACATAATAAGAATGG - Intronic
959782467 3:110252252-110252274 TCAAATAATCAGAATCAGAAAGG - Intergenic
960150080 3:114240330-114240352 TTTAATCAGCAAAATGAAAATGG - Intergenic
960169283 3:114439427-114439449 TCAACTTAGCATAATAAGAAAGG - Intronic
960478710 3:118162117-118162139 TTCAATAACCATAATGATCAGGG - Intergenic
960645177 3:119872421-119872443 TTAAATACATATAATGACAAGGG - Intronic
960671228 3:120157032-120157054 ATAAATCAGCATAAGGAGATGGG - Intergenic
960751823 3:120963313-120963335 TTGAATAGGAATAGTGAGAAAGG + Intronic
960781065 3:121317980-121318002 ATAAATAAGAAGAATTAGAAGGG - Intronic
963371808 3:144410926-144410948 TTTAATAAGAACGATGAGAAGGG + Intergenic
963438189 3:145299680-145299702 TAAATTAATCTTAATGAGAAAGG + Intergenic
963884291 3:150562993-150563015 TTAAATAATTATTATGTGAAAGG + Intronic
963999301 3:151749882-151749904 TTAAATAGGTATAGTGAGAATGG + Intronic
964326804 3:155555743-155555765 TTAGGTAAGCAAAATGAGAAGGG - Intronic
964460228 3:156916793-156916815 TTGAATAAGAGTAATGAGAGAGG + Intronic
965327078 3:167319863-167319885 TCAAATAAGCAAAGGGAGAATGG + Intronic
965911062 3:173776402-173776424 TTAAATAATTAAAATGAGAGAGG - Intronic
965983432 3:174722102-174722124 GTAAATAAGAAGAATGGGAAAGG - Intronic
966361911 3:179138870-179138892 TCAAATAAACACAATTAGAAAGG + Intergenic
966364529 3:179169728-179169750 TGAAAGAAGAGTAATGAGAAGGG - Intronic
966384230 3:179378344-179378366 TTAAATAAGCACATAGAGGATGG + Exonic
966460617 3:180172190-180172212 TTAAAAAATGAGAATGAGAAAGG + Intergenic
966676301 3:182594042-182594064 TAAAATAATAATAATGAGACTGG + Intergenic
967132660 3:186486836-186486858 TTAGATAAGTGCAATGAGAATGG - Intergenic
967358662 3:188604363-188604385 TTAAATAAACTTACTAAGAAAGG - Intronic
967490391 3:190083979-190084001 TTTAAAAAACATAATGAGAATGG - Intronic
967544151 3:190703591-190703613 TTATATATGCATAGTGAAAAAGG - Intergenic
969381363 4:6800712-6800734 TCAAACAAGTATAATGAGCAAGG - Intronic
970459045 4:16254629-16254651 CTAAATCAGAATAATGAAAATGG - Intergenic
970538138 4:17050899-17050921 ATAATTAAGCTTAGTGAGAAAGG - Intergenic
970764132 4:19525837-19525859 TAAATTACTCATAATGAGAATGG + Intergenic
970782758 4:19758656-19758678 TTAAGTAAGTCTATTGAGAAAGG - Intergenic
971039691 4:22738005-22738027 TTAAAAAGTCATAATTAGAATGG - Intergenic
971061463 4:22976687-22976709 TTAAAACAACATTATGAGAAAGG - Intergenic
971548866 4:27923397-27923419 TCAAATAACCATACTGAGATTGG + Intergenic
971550324 4:27946896-27946918 TAAAAAAGGCAAAATGAGAATGG + Intergenic
971626621 4:28928698-28928720 TGAAATAAGGAAGATGAGAAAGG - Intergenic
972121297 4:35707645-35707667 TTAAATAGGCATAGTGAGACTGG + Intergenic
972589866 4:40474864-40474886 TTGATTCATCATAATGAGAAGGG + Intronic
972718433 4:41672554-41672576 TCAAATACTCATTATGAGAAGGG - Intronic
972873829 4:43333086-43333108 CTAAAGAAGCATAATGACAGTGG + Intergenic
972997538 4:44899984-44900006 TTAAATCATTATAATGAGAATGG + Intergenic
973277115 4:48321754-48321776 TTAATTAAGCATAATGTACAAGG - Intergenic
973322187 4:48821499-48821521 TTAAATAGGAATGATGAGAGAGG - Intronic
973826873 4:54716367-54716389 TTACAAAAGCATTATGTGAAGGG + Intronic
974116879 4:57589879-57589901 ATAAATAATCATAAACAGAATGG + Intergenic
974256437 4:59461366-59461388 AAAAATAAAAATAATGAGAAAGG - Intergenic
974391598 4:61277426-61277448 ATAAATAGGTTTAATGAGAAGGG - Intronic
974476742 4:62391601-62391623 TTAAAACAGGATAATGAGGATGG - Intergenic
974496935 4:62642330-62642352 TTAAAAAAGCAAAATGAAAAAGG - Intergenic
974562836 4:63543584-63543606 TTAAATAAGAATGATGAGAGTGG - Intergenic
975172998 4:71254499-71254521 TGAAAAAAGAAAAATGAGAATGG + Intronic
975310256 4:72896374-72896396 TAAAATAAGCATTATGAATAAGG + Intergenic
975875485 4:78831033-78831055 ATAGTTAAGCTTAATGAGAAAGG - Intronic
975890659 4:79023302-79023324 TGAAATAATCATGATGAGAAAGG - Intergenic
976319598 4:83698538-83698560 TTAAATCAGCTTAATGAATAAGG + Intergenic
977347269 4:95832423-95832445 TTAAAAAAGTGTAATGAGAAAGG + Intergenic
977437746 4:97021373-97021395 TAAAATAAGAAAAAAGAGAAAGG - Intergenic
977442250 4:97082969-97082991 GCAAATAAGCACAATCAGAAAGG - Intergenic
977773673 4:100891672-100891694 TTAAACATGCATAATGTAAAAGG + Intergenic
977822878 4:101496359-101496381 CTAAAAAAGAATAGTGAGAAGGG - Intronic
977852863 4:101851054-101851076 ATAATTAAGCTTAGTGAGAAAGG + Intronic
978123908 4:105112436-105112458 GCAAATATGCATATTGAGAATGG - Intergenic
978335172 4:107659472-107659494 GTAGTTAAGCATGATGAGAATGG - Intronic
978517933 4:109588977-109588999 TGAAAAAAAAATAATGAGAAGGG + Intronic
978677036 4:111330921-111330943 TAAAATAAGCTTAGTGAGTAAGG + Intergenic
979087570 4:116432475-116432497 TTAAATAAGAATATTGTGATGGG - Intergenic
979914183 4:126409698-126409720 TCAAATAAGCACAATGGCAAAGG + Intergenic
980015032 4:127639901-127639923 TTAAGTAAGCATCAAGAGATTGG - Intronic
980081166 4:128345567-128345589 TTAAATAGGGATAATGATGATGG + Intergenic
980141198 4:128919688-128919710 ATAAATAATCATAATGACAAGGG + Intronic
980161366 4:129167541-129167563 TTCAATAAACATTATTAGAAAGG - Intergenic
980163529 4:129196809-129196831 TTTAATAAGCATATTGAGCAAGG - Intergenic
980314383 4:131177906-131177928 TAAAATTTGCAAAATGAGAAGGG - Intergenic
980372150 4:131889282-131889304 TTAGATAAATATATTGAGAAGGG - Intergenic
980519011 4:133906520-133906542 TTGAATAAACATAGTGAAAATGG + Intergenic
980653588 4:135752888-135752910 TTCAATAAAAATAAAGAGAATGG + Intergenic
981632727 4:146839700-146839722 TTAAAAAAGAAAAATGATAAAGG + Intronic
982102887 4:151985610-151985632 TTAAAGAAGCATAATGGGCAAGG + Intergenic
982306846 4:153941515-153941537 CAAACTAAGGATAATGAGAATGG - Intergenic
982715460 4:158802444-158802466 TTAAATGAGAATAATCAGAATGG + Intronic
983087437 4:163464520-163464542 ATAAATTAGCATAATGACTATGG + Intergenic
983169053 4:164515224-164515246 ATAAATAATAGTAATGAGAAGGG + Intergenic
983259978 4:165444934-165444956 TAAAATAAGAAGAAAGAGAATGG - Intronic
983355222 4:166648279-166648301 TTGAATAAGAGTGATGAGAAGGG + Intergenic
983460499 4:168020618-168020640 TTAAAGAAGCATAATAAAATGGG + Intergenic
983632735 4:169866001-169866023 TGAAATAATCATAAGGAGATAGG + Intergenic
983652787 4:170050353-170050375 ATAATTAAGCTTAGTGAGAAAGG - Intergenic
983973605 4:173904240-173904262 TTAAGTAGGCAAAATGACAAAGG - Intergenic
984001916 4:174257513-174257535 TTAAATGGGCATAATAAGACTGG + Intronic
984258153 4:177411603-177411625 TTAATTAAGCAAAATGAGCTGGG - Intergenic
984711613 4:182890292-182890314 TTAAATGAGATTAAAGAGAAGGG + Exonic
985232388 4:187834519-187834541 TTAATTAAGTAAAATGAGAAAGG + Intergenic
985870895 5:2555992-2556014 TTTAAAAAGCAGAATGAGAATGG - Intergenic
986723814 5:10579717-10579739 TTAAAGAAACCTAGTGAGAAAGG + Intronic
987522613 5:19006128-19006150 TTAAATAAGCTTAACTAGGAAGG - Intergenic
987874378 5:23660999-23661021 TTAAATAAACATATTGAGAAGGG - Intergenic
987944247 5:24584273-24584295 TTAAATACAGATGATGAGAAAGG + Intronic
987978088 5:25042294-25042316 ATAATTAAGCTTAGTGAGAAAGG + Intergenic
988054873 5:26081500-26081522 TGAAGTAAACATAATCAGAAAGG - Intergenic
988209260 5:28181885-28181907 TTGAATAAGCATAGTGATAGTGG + Intergenic
988343202 5:30001761-30001783 TATTATATGCATAATGAGAAGGG + Intergenic
989081420 5:37626159-37626181 TTGAATAAGAATACTGAGATTGG + Intronic
989288220 5:39729267-39729289 TTGAATAGGGGTAATGAGAATGG + Intergenic
989342021 5:40386865-40386887 TAAAATAAGCAAAATGAAACAGG - Intergenic
989532723 5:42526037-42526059 TTAATTAAGCTTAGTGAGGAAGG + Intronic
989691480 5:44150168-44150190 TAAAATAAAAATAATAAGAAGGG - Intergenic
990398519 5:55410794-55410816 TTAAATACGTATTATTAGAAAGG + Intronic
990435886 5:55791376-55791398 TTTAATAAGTATACTAAGAAAGG - Intronic
990847294 5:60156842-60156864 TTATATAAGCATCATGAGTTAGG - Intronic
991226661 5:64281338-64281360 TTGACTAGGCATGATGAGAATGG + Intronic
991293868 5:65060805-65060827 CTAAATAAGCAGAATGGTAAGGG + Intergenic
991556826 5:67904494-67904516 GTAATTAAGCATATTGAGATGGG + Intergenic
992243907 5:74797926-74797948 ATATATAAGCTTAATGAGCATGG + Intronic
992991125 5:82284923-82284945 TAAAACAAGCATACTGTGAAAGG - Intronic
993518829 5:88872940-88872962 TTAAACAAGCATAAAGAGTTTGG - Intronic
994431669 5:99672988-99673010 ATAAATGAGAACAATGAGAATGG + Intergenic
994537902 5:101055291-101055313 TTGAATAAGAACAGTGAGAAAGG + Intergenic
994784976 5:104147078-104147100 TTTAAAAAGTAAAATGAGAAAGG + Intergenic
994832468 5:104803244-104803266 GTAAATAAACATAATCAGAAAGG + Intergenic
995674426 5:114647143-114647165 CCAAATAAGCACAATCAGAATGG + Intergenic
996626749 5:125579461-125579483 GTAAATAAGAATTATGGGAAAGG + Intergenic
996753694 5:126914659-126914681 ATAAATTAGTATAAGGAGAAAGG - Intronic
996852805 5:127971521-127971543 TTTAATAAGAAGAAAGAGAAAGG - Intergenic
996882381 5:128314298-128314320 ATAAATAAACCTAATTAGAAGGG - Intronic
997251662 5:132393365-132393387 GTAAATAAGAATAATCAGCATGG + Intronic
997332026 5:133070977-133070999 TTAAATAGGCAGAATAACAAAGG - Intronic
998531875 5:142892583-142892605 AGAAATAAGAATAATGATAATGG - Intronic
998981915 5:147713431-147713453 TTAAAACAGCATAATGAAACAGG + Intronic
999776845 5:154818767-154818789 TTCAATATGCTTAAAGAGAAGGG - Exonic
999835133 5:155362036-155362058 ATAATTAAGCTTAATGAGGAAGG - Intergenic
1000593749 5:163189964-163189986 TGCAATAAGGATAAAGAGAAAGG + Intergenic
1000652619 5:163835701-163835723 TGAAATAACTATAATGAGTATGG - Intergenic
1000952149 5:167497733-167497755 TTAATTAAGGATGATGATAAAGG - Intronic
1001828196 5:174763419-174763441 TAAAATAAGTAATATGAGAAAGG - Intergenic
1002747102 6:67434-67456 TTAAATAAGCATACTTAAAATGG + Intergenic
1002943100 6:1734850-1734872 TCAAATAATAATAATGATAATGG + Intronic
1003356448 6:5377525-5377547 TTAAATAATAATAATAATAATGG - Intronic
1004090754 6:12498240-12498262 ATAAATAATAATAATGAGGAAGG + Intergenic
1004134824 6:12956602-12956624 TCAAATAAGCATAATGCCCAAGG - Intronic
1004188000 6:13438287-13438309 TTACATAAGAATGAAGAGAAAGG + Intronic
1004254701 6:14052282-14052304 TTAAATAAGCATTATGGGCTAGG - Intergenic
1004804305 6:19185346-19185368 TTGAAGAAGCACACTGAGAAAGG + Intergenic
1004815566 6:19308550-19308572 TTTAATAAGCATTAATAGAATGG + Intergenic
1004925723 6:20413398-20413420 TGAGATAAGCATTATGTGAATGG - Intronic
1005145958 6:22690390-22690412 ATAAATAAAAATAATGATAATGG + Intergenic
1005244045 6:23861631-23861653 TTGAATAAGTGTGATGAGAATGG - Intergenic
1005422032 6:25661078-25661100 GGAAAAAAACATAATGAGAAGGG - Intronic
1007675554 6:43591245-43591267 TTTAATTATCATAATAAGAAAGG + Intronic
1008010715 6:46465025-46465047 TTCAATAAACATAATAAAAAGGG + Intronic
1008194115 6:48497033-48497055 TAAAATTAGCAAAATCAGAAGGG - Intergenic
1008350554 6:50484749-50484771 AAAAAAAAGAATAATGAGAATGG - Intergenic
1008646939 6:53524120-53524142 TTAAATAAGCATAATGAGAAAGG + Intronic
1010062351 6:71637726-71637748 TTGAATAAGAGTGATGAGAATGG - Intergenic
1010396063 6:75393477-75393499 CAGAAAAAGCATAATGAGAAAGG + Intronic
1010867588 6:80998393-80998415 ATAAATAAGCACAATAAGGAAGG + Intergenic
1012386768 6:98691725-98691747 TTAAATGTCCATAATGAGATAGG + Intergenic
1012575032 6:100784819-100784841 TAAAATAAACAAAAGGAGAAAGG + Intronic
1012872232 6:104686018-104686040 TAAAACAGGCTTAATGAGAAAGG - Intergenic
1012965056 6:105665122-105665144 ATGAATAAGCTTAATGAGGAAGG - Intergenic
1013241785 6:108253109-108253131 TGAGATAAGCATGATGATAAAGG + Intronic
1013332422 6:109117942-109117964 TTAAATAAGCACATTGGAAACGG + Intronic
1014108096 6:117589877-117589899 TGAAATAAGAATATTGAGTATGG - Intronic
1014178981 6:118363584-118363606 TAAAATATGGCTAATGAGAAAGG - Intergenic
1014507348 6:122275959-122275981 TTAAATAAGCCTTATAAGATAGG - Intergenic
1014599636 6:123394333-123394355 TTAAATATACTTAATCAGAATGG + Intronic
1014659689 6:124153858-124153880 TTACATAAATATAATGAGAGTGG + Intronic
1014963135 6:127712147-127712169 TTAAATCAGCTTATTGACAAGGG - Intronic
1015047810 6:128798040-128798062 TTAAATAAGAATGGTGAGAGTGG - Intergenic
1015408608 6:132865950-132865972 TTAATTAGGCAGAATGAGTAAGG + Intergenic
1015660515 6:135569278-135569300 TTAAATAATCATAATAAGCAGGG - Intergenic
1015745107 6:136501583-136501605 ATAAATAAGATTAATGAGACAGG - Intronic
1016946185 6:149536360-149536382 ATGATTAAGCATAGTGAGAAAGG + Intronic
1017372321 6:153726866-153726888 TTTAAGAAGCATAATATGAAGGG + Intergenic
1017699268 6:157052555-157052577 TTAAACAGGCATAATCTGAATGG + Intronic
1018881393 6:167885358-167885380 TTGATTAAACATAGTGAGAAAGG - Intronic
1020648843 7:10850405-10850427 TAAAATTTGCATAATGACAAAGG + Intergenic
1020689847 7:11340341-11340363 TTACAGAATCATAATGAGCAAGG + Intergenic
1020859778 7:13477072-13477094 ATGATTAAGCTTAATGAGAAAGG - Intergenic
1021169207 7:17377558-17377580 TAAAATAAAGATAAAGAGAAGGG - Intergenic
1021192614 7:17639159-17639181 TTAAGTATGCATAATGAGCCAGG + Intergenic
1021501215 7:21334176-21334198 TTAAATAAGAATCAAGAGACTGG - Intergenic
1021928629 7:25557336-25557358 TTAAATTAGCAAAATGAAAAAGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023657876 7:42444187-42444209 CCAAATAAACATATTGAGAAAGG - Intergenic
1024457387 7:49625173-49625195 ATAAATAGACATAATGAGACTGG + Intergenic
1025151636 7:56558986-56559008 TAAAATAAAAATAATGATAATGG + Intergenic
1025868810 7:65411345-65411367 TAAAATAAGCAAAATAAAAAAGG + Intergenic
1026989291 7:74574296-74574318 TTAAATAAGAATAATGAGGCCGG - Intronic
1027552539 7:79617144-79617166 CTAAATACACCTAATGAGAATGG + Intergenic
1027618638 7:80455547-80455569 TTAAATGACCAAAATGAAAATGG - Intronic
1027795181 7:82683843-82683865 TTAAGTATGCTTAAGGAGAAAGG - Intergenic
1027815437 7:82963743-82963765 TTAAATAAATATAATAACAATGG + Intronic
1027838354 7:83275540-83275562 TCAAATAAGTTTAATTAGAAAGG - Intergenic
1028046226 7:86122808-86122830 TAAAATAACCTTAATGAAAAGGG + Intergenic
1028067735 7:86408611-86408633 TTAAATATGAATAATAATAATGG + Intergenic
1028212430 7:88091232-88091254 TTAAGTAAGCAAAATGAGTTTGG - Intronic
1028519336 7:91712383-91712405 ATAAATAAGAATAATGAAAGTGG - Intronic
1028899807 7:96084747-96084769 TTAAAAATGTTTAATGAGAAGGG + Intronic
1030469618 7:109947364-109947386 GTAAATAGGCATCCTGAGAAGGG - Intergenic
1030503596 7:110390541-110390563 GGAAATGTGCATAATGAGAAAGG + Intergenic
1031235700 7:119173555-119173577 TTATATTTGCATAATAAGAATGG - Intergenic
1031413095 7:121464298-121464320 ATAAGTAAGCACAATGAAAAAGG + Intergenic
1031727018 7:125252629-125252651 TTAAATAAGCAAAACTAAAAAGG + Intergenic
1031822063 7:126514777-126514799 TTTAATTAGTACAATGAGAATGG - Intronic
1032699095 7:134363163-134363185 TTGAATAAGCAGCATGAGAAGGG - Intergenic
1033091120 7:138387094-138387116 TTGAACAAGCAGAATGTGAATGG + Intergenic
1033497909 7:141918044-141918066 TTAAATGAACATAATGCAAATGG + Intronic
1033819115 7:145112087-145112109 TTAAATAAGAATGGTGAGAGAGG + Intergenic
1033839663 7:145358898-145358920 TAAAATAAGAATAATGATTATGG - Intergenic
1033839674 7:145359236-145359258 TAAAATAAGAATAATAACAATGG + Intergenic
1034675899 7:152892367-152892389 TTAAATAATAATAATGATACCGG + Intergenic
1034687047 7:152981302-152981324 TCAAAAAAGCATAAATAGAAGGG - Intergenic
1034867555 7:154655347-154655369 TCAAATAAGCAAAATCAGAATGG + Intronic
1035007277 7:155675376-155675398 TAAAATAACCCTAATGACAAGGG - Intronic
1035017256 7:155777488-155777510 GGAAAGAAGCAGAATGAGAAAGG + Exonic
1035562997 8:621521-621543 TTAAATAATTAAAAAGAGAAAGG + Intronic
1035637751 8:1159946-1159968 TTAAATAAGCATCACCTGAAAGG + Intergenic
1036184482 8:6612272-6612294 TTAAATAGGCAGAATGTGATGGG - Intronic
1036935949 8:13003010-13003032 ATAAATACACATAGTGAGAATGG - Intronic
1037252328 8:16910952-16910974 TTTAATAAGTATTATGATAATGG - Intergenic
1038111707 8:24506940-24506962 TAAAGAAAGCTTAATGAGAATGG - Intronic
1038272837 8:26090065-26090087 ATAAATAGACATAATGAGAGAGG + Intergenic
1039027500 8:33273513-33273535 TTGTAAAAGCAAAATGAGAAAGG + Intergenic
1039294743 8:36138223-36138245 TTAAGTAATCATATTGAGACAGG + Intergenic
1040636286 8:49277389-49277411 GTAATTAAGCTTAATGAGGAAGG + Intergenic
1040722795 8:50346572-50346594 ATAATTAAGCTTAATGAGAAAGG + Intronic
1041295090 8:56348188-56348210 CCAAATAAACATAATCAGAAAGG - Intergenic
1041719550 8:60963933-60963955 AAAAATATGCATAATGAGACAGG + Intergenic
1041880684 8:62746339-62746361 TTAAATTAGGATCATGAGATGGG - Intronic
1041986413 8:63926140-63926162 TTAAATCAGCAGGCTGAGAAGGG + Intergenic
1042083639 8:65085136-65085158 TTAAATAAGCATCTTTACAAAGG + Intergenic
1042817780 8:72896718-72896740 TTGAAAAAGCACAGTGAGAAAGG - Intronic
1043359228 8:79451644-79451666 TCAAATAGGCTTAATGAAAAGGG - Intergenic
1043793134 8:84499246-84499268 TTAAGAAAGCAAAATGATAAAGG - Intronic
1043836850 8:85057899-85057921 TTACATAATGATAATGATAAAGG - Intergenic
1044675517 8:94724468-94724490 TTAAAGAGGCATAATGAGGAAGG + Intronic
1045041884 8:98232679-98232701 TTAAAAAAGAAAAAAGAGAAAGG + Intronic
1045737437 8:105313220-105313242 TTAATTAGGCATATTGAGACAGG + Intronic
1045837031 8:106534812-106534834 TTAAAGAAGCAGAAAGAAAATGG + Intronic
1045946109 8:107798098-107798120 TGAGACCAGCATAATGAGAAGGG + Intergenic
1046006102 8:108487325-108487347 TTAAAGAATCATAAAGAGTAGGG + Intergenic
1046079077 8:109348717-109348739 TAAAATGAGCATTATCAGAAGGG - Intergenic
1046173923 8:110549939-110549961 TCAAATAAGCCCAATGAGAGGGG - Intergenic
1046536848 8:115525561-115525583 CTAAATAATCAGATTGAGAATGG - Intronic
1046594113 8:116240133-116240155 ATAAATATGAATAATGTGAATGG + Intergenic
1046760363 8:118014073-118014095 TTAAATAAAGATAATGATGATGG + Intronic
1046940843 8:119929998-119930020 TGAAATCAACATAATGAGACTGG - Intronic
1047157351 8:122334578-122334600 TTAAATATGCATCATTAAAATGG + Intergenic
1048515674 8:135108058-135108080 TCAAATAAGCGCAATCAGAAAGG - Intergenic
1048896351 8:138995890-138995912 TTAAATCAGCAGAATGAGTAAGG - Intergenic
1050524559 9:6534259-6534281 GTATAAAAACATAATGAGAATGG - Intronic
1050524673 9:6535119-6535141 GTATAAAAGCATGATGAGAATGG - Intronic
1051319953 9:15892239-15892261 TTAAATAGGCATGGTGAGAGAGG + Intronic
1052108481 9:24549274-24549296 ATAAATTAGCTTAATGACAATGG - Intergenic
1052146411 9:25055473-25055495 TTAAAAAAGCCTAAGGTGAATGG - Intergenic
1052394256 9:27919179-27919201 TTGAATAAGTATATTGAGAGTGG + Intergenic
1053302048 9:36959186-36959208 TAAGATAAGAAGAATGAGAAGGG - Intronic
1053388276 9:37713171-37713193 TTTAAAAAGGATAATGAGGATGG + Intronic
1055101343 9:72468883-72468905 TTAAAAAAGAACAATGTGAAAGG - Intergenic
1055420340 9:76134013-76134035 TTAAAAAAGCAAAATCAAAATGG - Intronic
1055534421 9:77223371-77223393 ATAATTAAGCTTAGTGAGAAAGG + Intronic
1055811308 9:80151394-80151416 TTGAATAAGAATATCGAGAATGG + Intergenic
1056023670 9:82468084-82468106 TAAAATAAGCATAAAGGTAATGG + Intergenic
1056187716 9:84152090-84152112 ATAAAAAAGCAAAAAGAGAAAGG + Intergenic
1056497614 9:87175445-87175467 TTATATAAGTTTAGTGAGAAGGG + Intergenic
1057223674 9:93272908-93272930 TTAAAAAATGATTATGAGAATGG + Intronic
1057536878 9:95918751-95918773 TTTAAAAAACACAATGAGAATGG - Intronic
1058293104 9:103268777-103268799 TTAAATAGGAATGATGATAATGG - Intergenic
1058928010 9:109687801-109687823 ATAACTAAGCTTAGTGAGAAAGG - Intronic
1059215560 9:112558259-112558281 AAAAATAAGAATAATGAGAAGGG + Intronic
1060701232 9:125750296-125750318 ATAAATACAAATAATGAGAAGGG - Intronic
1060952938 9:127616132-127616154 TTAAATAAATAAAATGATAAAGG + Intronic
1061494655 9:130965278-130965300 TTGATTAAGCTTAATGAGGAAGG + Intergenic
1203532403 Un_GL000213v1:158691-158713 TTGAATAAGAATGGTGAGAAAGG + Intergenic
1203445400 Un_GL000219v1:49344-49366 TGAAAAAAGTATAATGTGAATGG - Intergenic
1185669643 X:1797389-1797411 TAAAATAAAAATAAAGAGAAAGG - Intergenic
1186028235 X:5337679-5337701 TTAAAGAATCATAATGGGAGTGG + Intergenic
1186311514 X:8324353-8324375 ATAATTTAGCATAAGGAGAAAGG - Intergenic
1186757037 X:12682611-12682633 TTAAAGAAGCCTAAGGGGAAGGG - Intronic
1187528690 X:20077045-20077067 TCAAATAATAATAATGAGAATGG + Intronic
1187765289 X:22634866-22634888 TTAAAAAAGAGTAATCAGAATGG + Intergenic
1188139950 X:26537638-26537660 TTAATTAAGTTAAATGAGAATGG + Intergenic
1188277098 X:28213907-28213929 ATAAATAAGCATTAAGTGAAAGG - Intergenic
1188305510 X:28556678-28556700 TTAAGTAAGGATATTGAGATGGG + Intergenic
1188796837 X:34477546-34477568 TTGAATAAGAATGATGAGAAAGG + Intergenic
1188833576 X:34930648-34930670 ATGATTAAGCCTAATGAGAAAGG + Intergenic
1188900799 X:35730956-35730978 TTCAATAAACACAATCAGAAAGG - Intergenic
1188990809 X:36817716-36817738 GTAAATAAGTATCATGAGATTGG - Intergenic
1189033451 X:37472425-37472447 TGAAATGACCATGATGAGAAAGG + Intronic
1189076770 X:37924040-37924062 TTATATAAGCTTTATGAGAGTGG - Intronic
1190482977 X:50896197-50896219 TTGATTAAGCTTAGTGAGAAAGG - Intergenic
1190958726 X:55224246-55224268 ATTAATAAGCATAGTTAGAAAGG - Intronic
1191764077 X:64677658-64677680 TTAAATAAAAATATTGAGATAGG - Intergenic
1192606357 X:72523056-72523078 TTAAATACACATAATGACATTGG - Intronic
1192886810 X:75344145-75344167 TTAAATAGGAGTGATGAGAAAGG + Intergenic
1192951123 X:76017612-76017634 TCAAATAAGCTCAATTAGAAAGG + Intergenic
1192989897 X:76439462-76439484 TTGAATAAGACTAATGACAATGG + Intergenic
1193007983 X:76642720-76642742 TTAAAGAAGAAGAATGAGAAAGG + Intergenic
1193418004 X:81248162-81248184 TCAAATAAGCATAATCAGAAAGG - Intronic
1193868992 X:86773829-86773851 TTAAATGGGCATGATCAGAAAGG - Intronic
1194120809 X:89961404-89961426 ATAATTAAGCTTAATGAGGAAGG + Intergenic
1194253420 X:91605740-91605762 GTAAAAAAGCAGAATGACAAAGG + Intergenic
1194718854 X:97317321-97317343 TTAAATAAGCATTATTCTAACGG + Intronic
1194817441 X:98461356-98461378 ATAAATAAGATTATTGAGAAAGG - Intergenic
1194851838 X:98880473-98880495 CTTTATTAGCATAATGAGAACGG - Intergenic
1194869778 X:99115015-99115037 TTAAAGAAGGATAAAGAAAAGGG + Intergenic
1195082332 X:101383461-101383483 AGAGATAAGGATAATGAGAAAGG - Intronic
1195103349 X:101577884-101577906 TTAAATAAGAATGGTGAGAGTGG + Intergenic
1195623076 X:106977961-106977983 TTCAATAAGCATCATAAGATGGG + Intronic
1195878624 X:109569399-109569421 TTAAATAAGCATATAGAGGATGG + Intergenic
1195890802 X:109692511-109692533 TTTATTAAACATAATGAAAAAGG + Intronic
1195972949 X:110493208-110493230 TTAAATAAAAGTGATGAGAAAGG + Intergenic
1196229401 X:113203381-113203403 TTAAATAACAATATTGAAAATGG - Intergenic
1196665952 X:118316664-118316686 AAAAAAAAGAATAATGAGAATGG + Intergenic
1197280983 X:124535592-124535614 TATAATAAGAATAATGAGGATGG - Intronic
1197374682 X:125667665-125667687 TTGAATAGGAATAATAAGAATGG - Intergenic
1197689730 X:129485332-129485354 ATAAATCAGCCTAATGAGAGGGG - Intronic
1197704053 X:129621177-129621199 TTAAATATACATAATTACAAAGG - Intergenic
1197939168 X:131771054-131771076 TGAAAAAAGCAAAATGAAAAAGG - Intergenic
1197939198 X:131771430-131771452 TGAAAAAAGCAAAATGAAAAAGG - Intergenic
1198068379 X:133122753-133122775 TTAAATAAGATTATTGAGGAAGG - Intergenic
1198501578 X:137254522-137254544 ATAAATAAACAGCATGAGAAAGG + Intergenic
1198938386 X:141924583-141924605 TTATACAAGCATAATGTTAAAGG - Intergenic
1198942417 X:141971159-141971181 TTAATTAAGGATATTGAGATGGG + Intergenic
1198946230 X:142018030-142018052 ATAAATATGCATATTGGGAATGG + Intergenic
1199023240 X:142907539-142907561 ATAATTAAGCTTAGTGAGAAAGG + Intergenic
1199030944 X:142999326-142999348 GTAAATCAGCATAATAGGAATGG - Intergenic
1199322639 X:146458720-146458742 CTAAATGAGCACAATCAGAAAGG + Intergenic
1199707809 X:150445872-150445894 TTCAATAAGAAAAATGAGGAAGG + Intronic
1200269144 X:154665121-154665143 TTAAAAAAGAATAACGACAATGG - Intergenic
1200316907 X:155143795-155143817 TTAAAATAGAATAATCAGAATGG + Intronic
1200473675 Y:3618909-3618931 ATAATTAAGCTTAATGAGGAAGG + Intergenic
1200572199 Y:4845330-4845352 GTAAAAAAGCAGAATGACAAAGG + Intergenic
1201262190 Y:12170349-12170371 TTAAATAGGAATGATGAGAGAGG + Intergenic
1201368690 Y:13236981-13237003 TTAAATAAGAATGATGAAAATGG - Intergenic
1201606000 Y:15786047-15786069 TTAATTAAGGATAATCAAAAAGG - Intergenic
1202173731 Y:22078536-22078558 TTAAATAATAATAATTACAATGG - Intronic
1202217630 Y:22507846-22507868 TTAAATAATAATAATTACAATGG + Intronic
1202325555 Y:23688213-23688235 TTAAATAATAATAATTACAATGG - Intergenic
1202545216 Y:25981841-25981863 TTAAATAATAATAATTACAATGG + Intergenic