ID: 1008648901

View in Genome Browser
Species Human (GRCh38)
Location 6:53544360-53544382
Sequence GGGGGTCCTCGAGCGCCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 139}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008648901_1008648914 15 Left 1008648901 6:53544360-53544382 CCGGGAGGCGCTCGAGGACCCCC 0: 1
1: 0
2: 2
3: 28
4: 139
Right 1008648914 6:53544398-53544420 CGCGGACCGCGATAGGGCCGGGG 0: 1
1: 0
2: 0
3: 0
4: 22
1008648901_1008648908 -3 Left 1008648901 6:53544360-53544382 CCGGGAGGCGCTCGAGGACCCCC 0: 1
1: 0
2: 2
3: 28
4: 139
Right 1008648908 6:53544380-53544402 CCCGGGCGCAGTGGAGAACGCGG 0: 1
1: 0
2: 0
3: 12
4: 162
1008648901_1008648910 8 Left 1008648901 6:53544360-53544382 CCGGGAGGCGCTCGAGGACCCCC 0: 1
1: 0
2: 2
3: 28
4: 139
Right 1008648910 6:53544391-53544413 TGGAGAACGCGGACCGCGATAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1008648901_1008648911 9 Left 1008648901 6:53544360-53544382 CCGGGAGGCGCTCGAGGACCCCC 0: 1
1: 0
2: 2
3: 28
4: 139
Right 1008648911 6:53544392-53544414 GGAGAACGCGGACCGCGATAGGG 0: 1
1: 0
2: 0
3: 0
4: 12
1008648901_1008648918 23 Left 1008648901 6:53544360-53544382 CCGGGAGGCGCTCGAGGACCCCC 0: 1
1: 0
2: 2
3: 28
4: 139
Right 1008648918 6:53544406-53544428 GCGATAGGGCCGGGGGCGTAGGG 0: 1
1: 0
2: 0
3: 3
4: 33
1008648901_1008648912 13 Left 1008648901 6:53544360-53544382 CCGGGAGGCGCTCGAGGACCCCC 0: 1
1: 0
2: 2
3: 28
4: 139
Right 1008648912 6:53544396-53544418 AACGCGGACCGCGATAGGGCCGG 0: 1
1: 0
2: 0
3: 0
4: 15
1008648901_1008648915 16 Left 1008648901 6:53544360-53544382 CCGGGAGGCGCTCGAGGACCCCC 0: 1
1: 0
2: 2
3: 28
4: 139
Right 1008648915 6:53544399-53544421 GCGGACCGCGATAGGGCCGGGGG 0: 1
1: 0
2: 0
3: 0
4: 36
1008648901_1008648913 14 Left 1008648901 6:53544360-53544382 CCGGGAGGCGCTCGAGGACCCCC 0: 1
1: 0
2: 2
3: 28
4: 139
Right 1008648913 6:53544397-53544419 ACGCGGACCGCGATAGGGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 18
1008648901_1008648917 22 Left 1008648901 6:53544360-53544382 CCGGGAGGCGCTCGAGGACCCCC 0: 1
1: 0
2: 2
3: 28
4: 139
Right 1008648917 6:53544405-53544427 CGCGATAGGGCCGGGGGCGTAGG 0: 1
1: 0
2: 0
3: 2
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008648901 Original CRISPR GGGGGTCCTCGAGCGCCTCC CGG (reversed) Intronic