ID: 1008649024

View in Genome Browser
Species Human (GRCh38)
Location 6:53544803-53544825
Sequence AGGGGCCGCCGCCGGGGAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 407}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008649024_1008649034 1 Left 1008649024 6:53544803-53544825 CCGGCTCCCCGGCGGCGGCCCCT 0: 1
1: 0
2: 4
3: 39
4: 407
Right 1008649034 6:53544827-53544849 GCGCCCAGGTGACAGACCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 150
1008649024_1008649033 0 Left 1008649024 6:53544803-53544825 CCGGCTCCCCGGCGGCGGCCCCT 0: 1
1: 0
2: 4
3: 39
4: 407
Right 1008649033 6:53544826-53544848 GGCGCCCAGGTGACAGACCCTGG 0: 1
1: 0
2: 3
3: 18
4: 171
1008649024_1008649040 21 Left 1008649024 6:53544803-53544825 CCGGCTCCCCGGCGGCGGCCCCT 0: 1
1: 0
2: 4
3: 39
4: 407
Right 1008649040 6:53544847-53544869 GGGTCCGACGCACCGCGCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 42
1008649024_1008649039 18 Left 1008649024 6:53544803-53544825 CCGGCTCCCCGGCGGCGGCCCCT 0: 1
1: 0
2: 4
3: 39
4: 407
Right 1008649039 6:53544844-53544866 CCTGGGTCCGACGCACCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 46
1008649024_1008649042 27 Left 1008649024 6:53544803-53544825 CCGGCTCCCCGGCGGCGGCCCCT 0: 1
1: 0
2: 4
3: 39
4: 407
Right 1008649042 6:53544853-53544875 GACGCACCGCGCGGAGGCGAAGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008649024 Original CRISPR AGGGGCCGCCGCCGGGGAGC CGG (reversed) Exonic
900096768 1:942970-942992 AGGGGCCGGCGCCGAGGGGAAGG + Exonic
900216034 1:1482130-1482152 TGGGGCAGCCACCGTGGAGCGGG + Exonic
900223153 1:1520133-1520155 TGGGGCAGCCACCGTGGAGCGGG + Exonic
900335482 1:2160949-2160971 AGGCGCCGCCGTCGGGGTGGAGG + Intronic
900476060 1:2876914-2876936 AGGGGCCGTCCCAGGGGTGCTGG + Intergenic
901198888 1:7455673-7455695 AGCGGGCGGCGCTGGGGAGCTGG + Intronic
901217354 1:7562178-7562200 AGGGGCCGGAGCTGGGGTGCCGG - Intronic
901332811 1:8423873-8423895 CGGGGCCGGGGCCGGGGCGCGGG - Intronic
901934619 1:12618803-12618825 GGGGGAAGCCGCTGGGGAGCAGG + Intergenic
902238015 1:15070147-15070169 AGGGGCTGCCGCCAAGCAGCTGG + Intronic
902336749 1:15758647-15758669 AGGGGCCGCTTCCGCGGGGCGGG + Intronic
902823161 1:18955885-18955907 GCGAGCCGCCGCCGGGGGGCAGG + Exonic
903000946 1:20265413-20265435 AGGGGCAGCTGCCTGGGAGGAGG - Intergenic
903078018 1:20787049-20787071 AGGCGCCACCTCCGGGGACCCGG + Intronic
903346241 1:22685937-22685959 CAGGGCCGCAGTCGGGGAGCAGG - Intergenic
903750045 1:25616257-25616279 CGGGGCAGCCGCCAGGGCGCGGG + Intergenic
904143221 1:28369881-28369903 AGGGGCCGCAGCCTGAGAGGAGG - Intronic
904181297 1:28668699-28668721 GGCCGCCGCCGCCGGAGAGCTGG - Intergenic
905308052 1:37032776-37032798 CTGGGCGGCCGCCCGGGAGCCGG - Intronic
905863892 1:41366514-41366536 GGGGGCGGCCGCCGTGGGGCCGG - Intronic
908272883 1:62437420-62437442 AGGGGCCGGCTCCCGGGCGCGGG + Intronic
910787997 1:91021660-91021682 GGCGGCCGCCGCCGCGGGGCGGG - Intronic
910935042 1:92480624-92480646 AGGAGCCGCCGCCCAGCAGCAGG + Exonic
912818720 1:112850164-112850186 GGGAGCCGGCGCTGGGGAGCCGG + Intergenic
913300689 1:117366780-117366802 AGGGGCGGCGGCAGCGGAGCCGG + Intergenic
913481577 1:119294082-119294104 AGGGGCTCCCGCCTGGGAACAGG - Intergenic
915246291 1:154558470-154558492 AGGGGGCGGCGCCGGGGGCCGGG - Exonic
915463525 1:156082828-156082850 CGGGGCCGGGGGCGGGGAGCCGG + Intronic
916647113 1:166797156-166797178 AGTGGCCTCCTCCTGGGAGCAGG - Intergenic
916920400 1:169460472-169460494 AGCGCCCGCCGCCGGCTAGCCGG + Exonic
917853228 1:179082529-179082551 GGGGGCAGCCTCCGCGGAGCAGG + Intronic
918001541 1:180502182-180502204 AGGGGACGACTCCGGGGAGGTGG - Exonic
918045927 1:180941071-180941093 AGGGGCAGCCGAGGGGGAGCCGG - Exonic
918434863 1:184500898-184500920 AGGGTCAGCTGCCGGGGGGCTGG - Intronic
919764109 1:201115272-201115294 AGGGGCGCCTGCCGGGGAGGGGG + Exonic
920352170 1:205344308-205344330 CGGAGCCGCCGCCGGGGAGGAGG + Exonic
922753522 1:228082117-228082139 CGGAGCAGACGCCGGGGAGCTGG - Intergenic
923043391 1:230336433-230336455 AGTGGCTGCTGCAGGGGAGCAGG + Intronic
923141387 1:231163373-231163395 AGCCGCCGCAGCCGAGGAGCCGG - Exonic
1062861366 10:812995-813017 AGAGGCGGCCGGCGGGGGGCCGG - Exonic
1065727203 10:28677679-28677701 AGTGGCCGCCGACGGGGGACCGG + Exonic
1067048850 10:43000690-43000712 AGGGGACGGGGCTGGGGAGCTGG + Intergenic
1068560795 10:58512806-58512828 AGGGGCGGCGGGCGGGGAGGGGG + Intergenic
1069890357 10:71648654-71648676 TGGGGCTGGCGCTGGGGAGCAGG + Intronic
1071086771 10:81875106-81875128 AGGGGACGGGGCCGGGGAGGGGG - Intergenic
1071545019 10:86522173-86522195 GGAGGCCGCCGCCCGGGAGCTGG + Intergenic
1074772254 10:116742019-116742041 AGGGCCCGCCGCCGGGTGGCCGG - Intronic
1075401300 10:122163381-122163403 ACGAGCCGCGGCCCGGGAGCTGG - Intronic
1075684286 10:124353234-124353256 AGGGGCCGGCGGGAGGGAGCTGG - Intergenic
1075895975 10:125994792-125994814 ATGGGCCACAGCCGGGGAGGAGG - Intronic
1075961242 10:126569021-126569043 AGGGGCAGCAGCCCGGGGGCAGG + Intronic
1075999906 10:126905889-126905911 AGCGGCCGGGGCCGGGGAGTTGG - Intronic
1076402009 10:130190719-130190741 AGTGGCGGCTGCCGGGAAGCAGG + Intergenic
1076730167 10:132434571-132434593 AGGGGCCGCCGTCCGGAGGCGGG - Intergenic
1076770075 10:132657952-132657974 AGGTGCTGGGGCCGGGGAGCAGG - Intronic
1076848876 10:133083318-133083340 AATGGCGGCCTCCGGGGAGCGGG - Intronic
1077073358 11:688129-688151 AGGTGGCGCTGCCGGGGAGGTGG - Intronic
1077253923 11:1572292-1572314 CGGGGCCGCCGGCGGGGATGAGG + Intergenic
1080887191 11:36377472-36377494 AGGGGCCCCGCCCGGGCAGCTGG + Intronic
1083265763 11:61546209-61546231 AGTGGCCGCCGCGGCGGGGCTGG - Exonic
1083430694 11:62612510-62612532 GGGGGCCACGGCCGGGGAGAGGG + Exonic
1084546846 11:69818946-69818968 AGCCGCCGCCGCCGCGGGGCGGG - Exonic
1084758304 11:71252538-71252560 AGGAGCCGCCGCCGCGGCTCAGG + Intronic
1084810218 11:71607491-71607513 AGGCGCCGCCCGCGGGGACCAGG + Intergenic
1085400077 11:76230590-76230612 AGGGTCAGCCCCTGGGGAGCAGG + Intergenic
1085474855 11:76783344-76783366 AGGGCCCGCGGCCGGGCCGCCGG + Intronic
1086724670 11:90167420-90167442 AGCGGCCGCGGCGGGGGCGCAGG - Intronic
1088889945 11:114036378-114036400 AGGGGACGCCGCAAGGGGGCAGG + Intergenic
1089662513 11:119994563-119994585 AGGGGCCTCCACTGGGGAGAAGG - Intergenic
1089687972 11:120169090-120169112 AGGGGGCGCAGCCGGGGCGCTGG + Exonic
1090758552 11:129815953-129815975 AGGGGGCCCCGCCAAGGAGCGGG + Intronic
1091396185 12:155458-155480 AGGGGGCGCCGAGAGGGAGCTGG - Intronic
1092204367 12:6606616-6606638 GGGGGCGCCTGCCGGGGAGCCGG - Intronic
1092743166 12:11649554-11649576 AGGGGCGGCCGCGGGGGCGCGGG - Intergenic
1092861513 12:12724039-12724061 AGGCGCGGCCGCCCGGGCGCGGG - Intergenic
1092861833 12:12725264-12725286 CGGGGCCGCGGCCGGAGCGCGGG - Intergenic
1094536197 12:31324597-31324619 CGGGGCCGCCGCCTGGGCGTAGG - Intronic
1095349203 12:41188915-41188937 TGGGGCCGCGGGCGGGGACCCGG + Exonic
1096241330 12:49961800-49961822 CGGGGCCGGCGCGGGGGGGCAGG - Intergenic
1097267543 12:57755032-57755054 CGGGGCGGGCGCCGGGGAGCGGG - Intronic
1097872401 12:64611591-64611613 AGGAGCCGCACCAGGGGAGCCGG + Intronic
1097929829 12:65170601-65170623 AGAGGCGGCGGCCGCGGAGCAGG + Exonic
1098255339 12:68610747-68610769 AGAGGCCGGCGCCGAGGACCCGG + Intergenic
1102003568 12:109573839-109573861 AGGGGCGGCGGCCGGGGAGGCGG + Exonic
1102278359 12:111599398-111599420 AGCGGCCGGCGCGGCGGAGCGGG - Exonic
1102933855 12:116881271-116881293 GGGGGCCGCGGCCGCGGTGCAGG + Exonic
1103359092 12:120342968-120342990 AGGGGCCGGGCCCGGGGAGTTGG + Exonic
1104727860 12:131088664-131088686 AGGGGCAGGAGGCGGGGAGCAGG + Intronic
1104862365 12:131930180-131930202 AGGTGCGGCCGCCGGGGAAGCGG + Intronic
1104970719 12:132529471-132529493 AAGGGCAGCCTCAGGGGAGCTGG - Intronic
1105217472 13:18297562-18297584 AGGGGGCGCCGCGGCGGCGCTGG + Intergenic
1106410111 13:29505746-29505768 AGGGGCGGCGGTCGGGGGGCAGG - Exonic
1106776673 13:33016326-33016348 AGCGGAGCCCGCCGGGGAGCGGG + Intergenic
1108688979 13:52846010-52846032 GGCGGCCTCCTCCGGGGAGCCGG + Exonic
1111822300 13:93228182-93228204 AGGGACCCTCGCCGGGGACCTGG + Intronic
1112507237 13:99982321-99982343 AGCGGCAGCCGCAGCGGAGCCGG - Exonic
1113393278 13:109918438-109918460 ATGGGCCGCCACCAGGGAACAGG - Intergenic
1113494151 13:110714388-110714410 GAGGGCCGCCGCTGCGGAGCCGG - Intronic
1113658563 13:112087447-112087469 AGGGGTCGCTGCCGGTGTGCTGG + Intergenic
1113737879 13:112690692-112690714 GGCGGCCGCGGCCAGGGAGCAGG - Intronic
1113949964 13:114066384-114066406 AGGGCCAGCGGCCGAGGAGCGGG + Intronic
1114259663 14:21027077-21027099 AGGGGCCTACGCAGGGGCGCAGG + Intronic
1115217312 14:31026192-31026214 TGGGGCCCCGGCCGGGGCGCAGG + Exonic
1115398584 14:32934899-32934921 CGGGGCGGCCGCGGGGGTGCCGG + Intergenic
1117157143 14:52951647-52951669 AGGTGCCGCACCCCGGGAGCTGG + Intronic
1117722036 14:58637886-58637908 AGGGGCCGGCGCGGGGAGGCGGG + Intronic
1118186488 14:63542943-63542965 AGGCTCCGCCGCCGCGGAACCGG - Exonic
1118930210 14:70234326-70234348 AGCGGACGCCCCCAGGGAGCTGG + Intergenic
1118992442 14:70809075-70809097 AGGGGCCGGGGCCGAGGAGGAGG - Exonic
1119779900 14:77270735-77270757 ACTGGCCGCTGCCGGGGCGCTGG - Intronic
1122183416 14:99971746-99971768 GGGGGCCGCCGCCGGGGGATGGG - Intronic
1122271043 14:100568567-100568589 AGGGAGCCCCGCCGGCGAGCCGG - Intronic
1122582165 14:102777679-102777701 AGGGGCCGCGGCGGGCGGGCGGG + Intronic
1122666619 14:103334447-103334469 AGGTGCCGCCGCCGAGCAGCGGG - Exonic
1122687747 14:103518113-103518135 AGGGGCTGCCGCTGTTGAGCGGG + Intergenic
1122768599 14:104086986-104087008 AGGGGCAGCTGCCAGGGAACAGG - Intronic
1123047798 14:105527045-105527067 AGGGGCCTCGGCCGGGGCCCAGG + Intronic
1123630625 15:22257849-22257871 GGGGGCCGCGGCCGCGGAACGGG - Intergenic
1124453875 15:29822557-29822579 CGGGGCCGCGGCGGGGGAGGGGG + Intronic
1124629503 15:31328427-31328449 AAGAGCCGCAGGCGGGGAGCGGG - Intronic
1124789881 15:32717834-32717856 AGGGGACCCCGCGGGGAAGCAGG + Intergenic
1125300888 15:38252636-38252658 AGGGGCAGCCGGCGGCGAGGCGG + Exonic
1125541191 15:40471042-40471064 CGGCGCCGCAGCCCGGGAGCCGG + Exonic
1126849844 15:52790249-52790271 GCGGGCCGCGGCAGGGGAGCCGG - Intronic
1127884818 15:63189756-63189778 AGGGGCCGCGGCCCGGGACCGGG + Intronic
1129082563 15:73052979-73053001 AGGGGGCGCCACCGGGGAAGGGG + Intronic
1129082572 15:73052997-73053019 AGGGGCGGCTGCCGGGGGGCAGG + Intronic
1129333220 15:74838320-74838342 GGAGGCCGCCGGCGGGGAGCAGG - Exonic
1129644738 15:77419835-77419857 TGGCGCCGCCGCCGGGGCTCTGG - Intronic
1129710723 15:77819204-77819226 AGGGGCGCAGGCCGGGGAGCCGG - Intronic
1131990495 15:98088637-98088659 AGGGGAAGGGGCCGGGGAGCGGG - Intergenic
1132099649 15:99014660-99014682 AGGGGAAGGGGCCGGGGAGCGGG + Intergenic
1132393128 15:101453333-101453355 AGGGGCAGCCTGCGGGGAGCAGG - Intronic
1132665341 16:1078909-1078931 AGAGGCAGCCCCCGGGGAGGAGG - Exonic
1132730004 16:1356504-1356526 AGGGGCCGTGGCCGGGGTTCTGG + Intronic
1132746578 16:1438766-1438788 TGGGGCCGGGGCCGGGGTGCAGG - Intronic
1132828895 16:1918138-1918160 GGGGGCCGGCGCGGGGGCGCGGG + Exonic
1132937372 16:2488000-2488022 AGGGGCCCCAGCGGGGCAGCTGG - Intronic
1132957574 16:2603610-2603632 AGGTGCCGCCGCTGTAGAGCCGG - Intergenic
1133021295 16:2968042-2968064 TGGGCCCGCCGCCGGCGAGATGG + Exonic
1133097591 16:3458046-3458068 AGGGGCCGCAGCCGGGACGGAGG - Intronic
1133739241 16:8639397-8639419 AGGGGCCGCCGCCAGTGTCCGGG - Intronic
1133784235 16:8963003-8963025 AGGGGCGGCCGCCGGGACCCCGG - Intronic
1134086754 16:11362552-11362574 AGGGGCCGCCGCCCGTGTGCTGG - Intronic
1136272194 16:29154928-29154950 AGGGGCCGCAGGGGGGCAGCTGG + Intergenic
1136499728 16:30664381-30664403 GGGGGCCGCAGCCCGGGAGGGGG - Exonic
1136555672 16:31006481-31006503 AGGGCCTGCCTCCAGGGAGCTGG + Intronic
1138451960 16:57098396-57098418 ACAGGCAGCCCCCGGGGAGCAGG - Intronic
1139597802 16:67968400-67968422 AGGGGCCGTGGCGGGGCAGCGGG - Intronic
1140223270 16:73058763-73058785 GGCGGCCGCAGCCGGGGAGCCGG + Intronic
1141132232 16:81444585-81444607 AGGGGCAGCCCCTGGGGAGGGGG - Intergenic
1141409112 16:83820570-83820592 AGGGGCAGCAGTCGGTGAGCAGG - Intergenic
1141430514 16:83968485-83968507 ACTGGCCGGCGCCGGGGGGCGGG - Intergenic
1141463372 16:84191443-84191465 AGGGGCCGGAGTCGGGGAACTGG + Exonic
1141693968 16:85611451-85611473 GGGGGGCGCCGCCGGTGAGCTGG + Intronic
1141946937 16:87317149-87317171 AGGCGCTGCTGCCGGGGGGCCGG - Exonic
1142075771 16:88116832-88116854 AGGGGCCGCAGGGGGGCAGCTGG + Intronic
1142155711 16:88532098-88532120 GGCGGCTGCGGCCGGGGAGCCGG - Exonic
1142223156 16:88865098-88865120 CGGGGGCTCCGCCGAGGAGCTGG - Exonic
1142236697 16:88925788-88925810 AAAGCCCGTCGCCGGGGAGCAGG - Intronic
1142350101 16:89575840-89575862 AGGGGCCGCTGCCCGCGAGTCGG - Exonic
1142687441 17:1585868-1585890 AGGGGCTGCGGGCTGGGAGCCGG + Intronic
1143018740 17:3905258-3905280 GGGGGCCGAGGCCAGGGAGCTGG + Exonic
1143188379 17:5023948-5023970 GGGGGCCGATCCCGGGGAGCGGG + Exonic
1143478881 17:7217537-7217559 AGGGGCCGTGGCGGGGGAGTGGG + Intronic
1143485387 17:7251347-7251369 GGGGGCTGCCCCCGGGGGGCTGG - Exonic
1143582233 17:7834185-7834207 AGGGGGCGGGGCTGGGGAGCGGG + Intergenic
1145781739 17:27568129-27568151 AGGGGCTGCCTGAGGGGAGCAGG + Intronic
1146057698 17:29589437-29589459 AGGGGCCGCCGCCGCCGCCCGGG - Exonic
1146654447 17:34626795-34626817 GGGGGCTCCCGCCGGGGGGCCGG + Intronic
1146889679 17:36498331-36498353 TGGGGCTGCCCCTGGGGAGCTGG + Exonic
1147393347 17:40122867-40122889 CGGGGCGGCCCCCGGGCAGCAGG + Intronic
1147719806 17:42532126-42532148 AGGCGCCGCCGCCGCCGGGCCGG + Intergenic
1148064991 17:44862646-44862668 AGGGGCTGCCCCCAAGGAGCTGG - Intronic
1148482878 17:47971413-47971435 AGGGGGCGCCACCGCGCAGCTGG + Intronic
1148642781 17:49200885-49200907 ATGGGCTGCTGCGGGGGAGCAGG + Intergenic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1148798123 17:50207144-50207166 AGGGGGCGTGGCCGGGGGGCGGG + Intergenic
1148911384 17:50944816-50944838 CGGGGCCGCCGCAGGAGCGCAGG - Intergenic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1152408005 17:80108416-80108438 GGGGGCCGCGGCCAGGGAGCAGG - Intergenic
1152652635 17:81502652-81502674 AAGGGCCGCCAGCAGGGAGCTGG + Intergenic
1152654833 17:81514669-81514691 AGGGGACGCCGCCGCGGGCCGGG + Intronic
1152755517 17:82085461-82085483 AGGTGCGGCCGCCGGGCAGGGGG - Exonic
1152843437 17:82585049-82585071 AGGGGCCACCGCCAGTGGGCAGG - Intronic
1153285712 18:3452346-3452368 AGGAGTCGGCGCCGAGGAGCTGG - Exonic
1153437121 18:5079440-5079462 AGGGGCAGCCACCGAGGATCCGG - Intergenic
1153854957 18:9136683-9136705 AGGGGCGGGCGCCGGGGGGCGGG + Intronic
1155519886 18:26657048-26657070 AGGGGCCGCGGCCGGGGGCCGGG - Intronic
1155570193 18:27184793-27184815 AGGGTGCCCCGCCGGGGCGCAGG + Intronic
1156008445 18:32470480-32470502 AGCGGCGGCCGCCGAGGCGCGGG - Intronic
1156698825 18:39799348-39799370 AGGGGGCGGCGGCGGGGGGCGGG + Intergenic
1157305987 18:46518110-46518132 AGGGGCCGCCTCCAGGTACCTGG + Exonic
1157610113 18:48950634-48950656 GGGGGCGCCCGCCGGGGATCGGG + Exonic
1159102347 18:63970619-63970641 AGGAGCCGCCGCTGCGGAGGAGG + Intronic
1159798082 18:72867708-72867730 CGGGGCCGGGGCCGGGGAGAGGG + Exonic
1160163208 18:76491268-76491290 CGGGGCCGGGGCCGGGGAGGGGG - Intronic
1160163330 18:76491555-76491577 GGGGGCGGGCGCCGGGGGGCGGG + Intronic
1160164052 18:76495119-76495141 AGGGGCCGCGGGCGGGGGGAGGG - Intronic
1160454690 18:78992425-78992447 AGGGGCCGCAGGCGGGGGCCGGG - Exonic
1160592533 18:79952145-79952167 CGGGGCCGTCGCCGGGGGGCCGG + Intergenic
1161031893 19:2061441-2061463 CGCGGCCGCCGCCGGGGAGGGGG - Intergenic
1161051610 19:2166846-2166868 TGGGGGCGCCGCAGGGAAGCTGG - Intronic
1161063604 19:2227160-2227182 AGGGGCCTCCGGCGGGGGCCGGG - Intronic
1161072688 19:2270501-2270523 CGCGGGGGCCGCCGGGGAGCTGG + Intronic
1161162206 19:2767813-2767835 AGGGGCCGCCGCCTGTGCTCTGG + Intronic
1161222037 19:3122317-3122339 GAGCGCCGCCCCCGGGGAGCGGG + Exonic
1161266408 19:3366680-3366702 CGGGGGCGCCGGCGGGGGGCCGG - Intronic
1161313138 19:3606218-3606240 GGGGGCTGCAGCCGGGGAGGGGG - Intronic
1161397999 19:4054803-4054825 GGGCGCCGACGCCGGGCAGCTGG - Exonic
1161401079 19:4066470-4066492 AGGGGGCGCCGCCCGGGAAGGGG - Intronic
1161689015 19:5720042-5720064 GCTGGCCGCCGCCGGGGGGCGGG - Exonic
1162022349 19:7873638-7873660 AGGGGCCGCCGCGCGGACGCCGG - Exonic
1162112001 19:8404476-8404498 AGGGGCCTCAGCCTAGGAGCTGG - Intronic
1162744243 19:12790037-12790059 GGGGGACGCAGCCGAGGAGCGGG - Intronic
1162992476 19:14312486-14312508 AGGAGCCGCAGCCGGGGTGGGGG + Intergenic
1163233835 19:16020060-16020082 AGGGTCAGCAGCCGGGGTGCAGG + Intergenic
1163304896 19:16471872-16471894 TGGGGGCGGCGCCGGGGTGCGGG - Intronic
1163552568 19:17973917-17973939 TGGGGCGGCCGCTGGGCAGCGGG + Exonic
1163558975 19:18008001-18008023 GGGGGCAGCCGGCGGTGAGCAGG + Intronic
1164256651 19:23533617-23533639 AGGGGCGGCTGCCGGGCAGAGGG + Intronic
1164756597 19:30694553-30694575 GGAGGCAGCCGCTGGGGAGCTGG - Intronic
1165349737 19:35269189-35269211 CGGGGCCGGGGCCGGGGCGCGGG - Intronic
1165420599 19:35720224-35720246 AGGGGCCGCGGCCGAGGTGGTGG + Exonic
1165421453 19:35723974-35723996 GGGGTCCGACGCCGAGGAGCAGG - Exonic
1166045398 19:40226846-40226868 AGGGGCTGCTTCCGGGCAGCAGG - Intergenic
1166765628 19:45251203-45251225 AAGGGCCGGCGGCGGGGGGCGGG + Intronic
1166984142 19:46649575-46649597 AGGCGCCGCCGCCGGGGGGCGGG - Exonic
1167237172 19:48322060-48322082 AGCAGCCGCCGCCGCGGAGGGGG - Intronic
1167781432 19:51601505-51601527 GGGGGCAGGCGCCGGGGCGCGGG - Intergenic
1168125466 19:54280193-54280215 AGGGGCCACCTCCGTGCAGCTGG - Intronic
1168169013 19:54574160-54574182 AGGGGCCACCCCCGTGCAGCTGG + Intronic
1168171788 19:54594525-54594547 AGGGGCCACCCCCGTGCAGCTGG + Intronic
1168239446 19:55081875-55081897 AGGAGCCGGCGCCGGGCGGCTGG + Exonic
1168401682 19:56088984-56089006 GGCGGCCGCGGCCGGGGAGGCGG + Exonic
925981124 2:9178412-9178434 AGAGGCAGCCTCCAGGGAGCAGG + Intergenic
926098352 2:10097425-10097447 AGGGGCCGCCGGGTGGGGGCTGG - Intergenic
926101640 2:10122233-10122255 CCGGGCCGCCGCCGGGCAGGGGG - Intergenic
926202672 2:10812810-10812832 AGGGGCGGCCGCGCGGGGGCGGG + Intronic
926252775 2:11165263-11165285 AGGGGCGGCTGCCGGGCAGAGGG + Intronic
926718620 2:15942693-15942715 AGGGCCCGCCGCCGGGGCACTGG - Exonic
927809474 2:26173437-26173459 CGGGGCCCACGCCGGGGAGCTGG - Intronic
927809554 2:26173659-26173681 AGGGGGCGCGGCCGGGGCGGGGG - Intronic
929188564 2:39120295-39120317 GGGGGCTGCGGCCGGGAAGCGGG + Intronic
929857544 2:45650031-45650053 CGGCTCCGCTGCCGGGGAGCTGG - Intergenic
931762888 2:65432384-65432406 CGGGGTCGCCCCCGGGGGGCCGG + Intronic
932231343 2:70086880-70086902 ACCGGCCGCCGCCGGGGAGCAGG + Intergenic
934882329 2:97995374-97995396 AAGGGCCGCGGCCGGGGCTCCGG - Intronic
936457492 2:112686537-112686559 AGGAGCCGCCTGTGGGGAGCAGG - Intergenic
937214199 2:120300713-120300735 AGGTGCTGCGGCCTGGGAGCAGG + Intergenic
939734549 2:145827671-145827693 AGGGGCTGCAGCAGGGCAGCAGG - Intergenic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
942928182 2:181457690-181457712 AAGGGCCGCCGTCCGGGAGACGG + Exonic
944412117 2:199456228-199456250 AGGGGCCCGAGCCGGGAAGCCGG + Intronic
945673893 2:212832820-212832842 AGTGCACGCCGTCGGGGAGCCGG - Intergenic
946195263 2:218028898-218028920 AGGGGCCGCAGCCTGTGAGTGGG - Intergenic
946339193 2:219057410-219057432 GTGAGCCGCCGCCGGGGGGCTGG - Intronic
948046581 2:234950789-234950811 AGGGGCAGCCGCAGGGGCTCGGG + Intergenic
948111989 2:235463739-235463761 AGAGCCCTCCGCTGGGGAGCAGG - Intergenic
948216538 2:236237337-236237359 GGGGGCCGGGGCCGGGGCGCGGG + Intronic
948216553 2:236237362-236237384 GGGGGCCGGGGCCGGGGCGCGGG + Intronic
948216568 2:236237387-236237409 GGGGGCCGGGGCCGGGGCGCGGG + Intronic
948216583 2:236237412-236237434 GGGGGCCGGGGCCGGGGCGCGGG + Intronic
948686236 2:239671345-239671367 AGGGGCCTCGGCCGGGCAGAGGG + Intergenic
949037425 2:241822251-241822273 AGGGGCCACAGCTGAGGAGCCGG + Intergenic
949079313 2:242084186-242084208 AGGGGCTGCAGCCGGTCAGCTGG + Intergenic
1169129699 20:3159740-3159762 AGTGGCGGCGGCCGGGGAGGAGG - Intronic
1172083252 20:32358753-32358775 TGCCGCCGCCGCCGGGGAGAAGG + Exonic
1172656457 20:36541415-36541437 CGGGGCCGCGGGCGGGGTGCGGG - Intergenic
1176004117 20:62850523-62850545 AGGGGGCGGCGCTGGGGAGGAGG - Intronic
1176068851 20:63215825-63215847 AGGGGCCGCGGCCGGGGCCGAGG - Intronic
1176120375 20:63451857-63451879 AGAGGCCGCTGCTGGGGAGTCGG - Intronic
1176122750 20:63461563-63461585 AGGGCCGGCCCCCGGGGTGCTGG - Intronic
1176143051 20:63553583-63553605 AGGGGCCGTTGCGGGGGAGGGGG + Intronic
1178707846 21:34889603-34889625 GGGGGCCGCTTCCGGGGAGCCGG - Intronic
1178992449 21:37367036-37367058 CGCTGCCGCCGCCGGCGAGCAGG + Intronic
1179674987 21:42974965-42974987 AGGCGCCGCCGCCGCCGCGCTGG + Intronic
1179799327 21:43803576-43803598 AGGGGCCGACCCCGAGGCGCGGG + Exonic
1180004604 21:45014559-45014581 AGGGGCCGCCCCCGCCGAGCAGG + Intergenic
1180649915 22:17369398-17369420 AGGGGCCGCCCACGAGGAGGGGG - Exonic
1181198180 22:21202728-21202750 AGGGGCCTGCGCCGGCCAGCAGG + Intergenic
1181934648 22:26429693-26429715 AAGCGCCGCCGCCTCGGAGCCGG + Intronic
1182096679 22:27630556-27630578 TGGGGGCGCCGCTGGGCAGCTGG + Intergenic
1183261486 22:36798559-36798581 AGGGGCTGGGGCTGGGGAGCGGG - Intergenic
1183578217 22:38706023-38706045 CCTGGCCGCCCCCGGGGAGCTGG - Exonic
1183601801 22:38844168-38844190 TGGGGGCGCCGCCGGGGATGCGG + Intergenic
1183780190 22:39994734-39994756 AGGGGACGCCCCCAGGGGGCGGG - Intergenic
1184276616 22:43412360-43412382 AGGGGGCTCCGCCAGGGCGCGGG + Intronic
1184513070 22:44944326-44944348 AGGAGCCACCGCCCAGGAGCTGG + Intronic
1184557493 22:45241034-45241056 AGGGGGCGGGGCCAGGGAGCCGG - Intergenic
1184658824 22:45955934-45955956 AGGGGCTGCCGCCAGGTAGCGGG + Intronic
1185096040 22:48806610-48806632 AGGGCCCGGAGCCCGGGAGCAGG - Intronic
1203228627 22_KI270731v1_random:92109-92131 AGGGGCCTGCGCCGGCCAGCAGG - Intergenic
949987775 3:9553554-9553576 AGGGGCTGTCCCCGGGGGGCTGG + Intronic
952316776 3:32238696-32238718 AGGGGAGGCTGCCGGGCAGCCGG - Exonic
953179857 3:40584983-40585005 AGGGAGCGCCGGCGTGGAGCAGG - Intergenic
953908955 3:46882375-46882397 CGGGGCCGCGGACGGGGCGCTGG + Intronic
954117144 3:48473236-48473258 AGGGGCGGGGGCCGGGGAGGAGG + Intronic
956892335 3:73624842-73624864 CGGGGTCGCCGCCGGGCGGCCGG + Exonic
961168716 3:124780759-124780781 AGGGGACACTGCCGGGGAGAGGG - Intronic
962367645 3:134796616-134796638 AGGGGCGGGAGGCGGGGAGCTGG - Intronic
962520743 3:136195847-136195869 GCGGGCCGCCGCCGGCGGGCGGG + Intronic
966108157 3:176362251-176362273 TGGGACCGGCGCCGCGGAGCAGG + Intergenic
966787837 3:183636450-183636472 TGCGGCCGTCCCCGGGGAGCCGG + Intronic
966868585 3:184276087-184276109 CGGGGCCGCGGCCCGGGAGCGGG + Intronic
967493648 3:190120422-190120444 CGGGGCCCTCGCCGGGGGGCGGG + Exonic
967889221 3:194353273-194353295 GGGGGCCGCTGAGGGGGAGCTGG - Intergenic
968068985 3:195774264-195774286 TGGGGCAGGCGCCGGGGACCTGG - Exonic
968174019 3:196533529-196533551 TGGGGGCGCCGCAGGAGAGCAGG + Intergenic
968433966 4:575726-575748 GGGGGCCGCGGCCGGGGCCCCGG - Intergenic
968443739 4:637631-637653 AGGAGCCGCGGCCTGGGGGCCGG + Intronic
968571807 4:1346281-1346303 GGGGGCCGCCGGCGGCGGGCCGG - Intergenic
968727687 4:2255887-2255909 GGCTGCCGCTGCCGGGGAGCTGG + Intronic
968815171 4:2818234-2818256 CCGGGCCGCGGCCGCGGAGCTGG + Exonic
975820735 4:78267866-78267888 AGGGGCCGCTTCCGTGGATCAGG + Intronic
975908934 4:79245846-79245868 AGGGGTGGCCGCCGGGCAGAGGG - Intronic
976389955 4:84497487-84497509 AGGGGCCGCGACCCGGGAGTGGG + Intronic
977564964 4:98571317-98571339 AGGGGCTGCTGGCGGGGAGGAGG + Intronic
977607200 4:98995498-98995520 AGGCACCGCCGGCGGGGGGCGGG + Intergenic
978384691 4:108167915-108167937 CGGGGCCGCCGGCCGGCAGCCGG + Exonic
981782376 4:148443714-148443736 AGCTGCCGCCGCCGGGCTGCGGG - Intronic
981782984 4:148445976-148445998 AGGGACCACAGCAGGGGAGCCGG - Intergenic
983752897 4:171298612-171298634 ACTGGGCGCCGCCGTGGAGCAGG - Intergenic
984206543 4:176793053-176793075 AGGTGGGGCCGCCGGGGAGGAGG - Intergenic
984708198 4:182863086-182863108 AGGTGCCGCCACCATGGAGCGGG - Intergenic
984778586 4:183504903-183504925 CGGGGCCGGCGCCGGGGTCCCGG - Intergenic
985504615 5:271850-271872 CGGGGCCGCCGCGGCGGAGGCGG - Intronic
985706895 5:1406538-1406560 AGGGGCTGTTGCCGGGGCGCGGG - Intronic
985713862 5:1445259-1445281 AGGGGCGGGGGCCGGGGACCGGG - Intronic
985763557 5:1764555-1764577 AGGAGCCGCAGCCGGAGAGCTGG + Intergenic
985801392 5:2007254-2007276 AGGCGCCGGGGCCGCGGAGCTGG - Intergenic
987050760 5:14144767-14144789 AGGCGCCGCCGCTGGGGTACCGG - Intronic
988755565 5:34244882-34244904 AGGGGACGGGGGCGGGGAGCAGG + Intergenic
990297747 5:54420607-54420629 AGGGGCGGCCGCCGGGCAGAGGG + Intergenic
994670238 5:102755078-102755100 AGAGGCCGCCGGCGTGGAGGAGG + Intronic
995764596 5:115602053-115602075 GGGGGCCGCCGCCGGGGGCGCGG - Intronic
997926123 5:138032799-138032821 AGCGGCCGCGGCCAGGGAACGGG - Exonic
998004853 5:138649982-138650004 TGGGGCTGCCACAGGGGAGCAGG + Intronic
998018841 5:138753371-138753393 GGGGGCCGCGGGCGGGGGGCGGG + Intronic
998337670 5:141387887-141387909 GGGGAGCGGCGCCGGGGAGCTGG + Exonic
998338780 5:141398130-141398152 GGGGAGCGGCGCCGGGGAGCTGG + Exonic
999219255 5:149961097-149961119 AGGGGTCGCCGCCGTGGAGCGGG + Intronic
999809620 5:155115137-155115159 AGGACCCGACGCTGGGGAGCAGG - Intergenic
1000014580 5:157266130-157266152 AGGGCCCCGCGCCGGGGCGCAGG - Exonic
1000203313 5:159033131-159033153 AGGAGCAGCCGCCTGGAAGCGGG + Intronic
1001381979 5:171311318-171311340 CGGGGCCGCCGGCGGGGCCCCGG - Intronic
1001396121 5:171420502-171420524 AGGGGGCGCGGCCGGGGAAGGGG - Intronic
1002897624 6:1388930-1388952 GGGGGCCGCCGCAGGGTTGCGGG - Intergenic
1003234275 6:4281945-4281967 GGGGACTGCCGCGGGGGAGCAGG - Intergenic
1003325231 6:5085674-5085696 AGAGGCCGCCCCCCAGGAGCAGG + Exonic
1003511940 6:6789004-6789026 AGTGGCTGCCTCTGGGGAGCAGG + Intergenic
1004140777 6:13014868-13014890 AGGGACCGCCGGCGCGGACCAGG + Intronic
1004492380 6:16129123-16129145 AGGGGCAGCTGGCGGGCAGCGGG + Exonic
1005554200 6:26956655-26956677 AGGGGACGGGGGCGGGGAGCAGG + Intergenic
1005826260 6:29633099-29633121 AGGAGGCGGCGCCGGGGACCAGG + Exonic
1005988069 6:30886375-30886397 AGGGTCCAGCGCCGGGGAGCAGG - Intronic
1006089752 6:31621186-31621208 CGGGGCGGCAGCCGGGGAGGGGG - Intronic
1006449120 6:34095848-34095870 AGGGGCCGCCACAGGTGGGCAGG + Intronic
1006950670 6:37819428-37819450 AGGGGCGCACGCCGGGGAGGGGG + Intergenic
1007630306 6:43269747-43269769 AGCCGCCGCCGCCGGGGTGAGGG - Intronic
1007902043 6:45422023-45422045 AGCGGCGGCCGCCGCGGAGGCGG + Intronic
1007927676 6:45663346-45663368 CGGGGCGGCCTCCGGGGAGGAGG - Intronic
1008630511 6:53359438-53359460 GGTGACCGCCGCGGGGGAGCGGG - Intergenic
1008649024 6:53544803-53544825 AGGGGCCGCCGCCGGGGAGCCGG - Exonic
1010703244 6:79077577-79077599 CGGGGTCCCCGCCGGGGCGCGGG - Intronic
1012170812 6:96015540-96015562 AGGAGCCGCCGCAATGGAGCGGG + Intergenic
1012479402 6:99650354-99650376 CGGGGCGGCCGCCGGGCAGAGGG + Intergenic
1013793619 6:113860201-113860223 GGGCGCGGCCTCCGGGGAGCAGG + Exonic
1016329954 6:142945375-142945397 GGGGGCACACGCCGGGGAGCGGG + Intergenic
1016433156 6:144008471-144008493 AGGAGGCCCCGCCGGGGAGCTGG + Intronic
1017756258 6:157531958-157531980 TGGGGCCTCTGCCAGGGAGCTGG - Intronic
1018727970 6:166627887-166627909 AGGGACCGCCGCCTGCCAGCGGG + Intronic
1018890105 6:167976990-167977012 AGGCGATGCCGGCGGGGAGCGGG + Intergenic
1019323282 7:425166-425188 AGCGGCCGCCCCTGGGGAGCGGG - Intergenic
1019374225 7:680608-680630 AAGGCCCGCCGCCGGCGAGGAGG - Exonic
1019408562 7:896858-896880 AGGGGCCGCCTGCGGGGCTCCGG - Intergenic
1019444957 7:1066434-1066456 AGGGCCCCCCGCCGGGAAACAGG - Intronic
1019606125 7:1911104-1911126 AGAGGCGGCCGCCCAGGAGCGGG - Intronic
1019664707 7:2246016-2246038 GGGGGCCGCAGCTGGGGAGGAGG + Intronic
1020004560 7:4775491-4775513 AGGTGCCGCGGCCGGGGGTCCGG - Intronic
1020085716 7:5309104-5309126 GGGGGCCGCAGCCGGGCCGCAGG + Intronic
1020100015 7:5389253-5389275 AGTGGCCGCCGCCAGGGGTCCGG + Exonic
1020106988 7:5426790-5426812 AGGGCGCGGGGCCGGGGAGCGGG - Intergenic
1020130498 7:5556334-5556356 AGGGGCCGCGGGCCGGGGGCGGG - Intronic
1020309117 7:6855570-6855592 AGGCGCCGCCCCCGGGGCCCAGG - Intergenic
1020756669 7:12211514-12211536 AGGGGAGGCCGCTGGGGTGCTGG + Intronic
1021685557 7:23182247-23182269 AGGGTCCGCCGGCGGGGACCGGG + Intronic
1022113828 7:27246425-27246447 AGGGGCCGCCGGCTGGCTGCCGG + Exonic
1023850128 7:44145832-44145854 AGAGGCCGCCGCTGGGGGGACGG - Intronic
1024931301 7:54668018-54668040 AGGGGCGGCTGCCGGGCAGAGGG + Intergenic
1025208586 7:57008045-57008067 GGGGGCCGCAGCCGGGCTGCAGG - Intergenic
1025663361 7:63568833-63568855 GGGGGCCGCAGCCGGGCTGCAGG + Intergenic
1028129373 7:87152380-87152402 AGGGGCAGCGTGCGGGGAGCTGG + Intronic
1029270573 7:99374757-99374779 AGAGTCCGCGGCCGGGGCGCGGG + Exonic
1029438074 7:100573616-100573638 AGCGGACGCCCCCAGGGAGCTGG - Intronic
1029456413 7:100674493-100674515 GGGGGCGGGCGCCTGGGAGCTGG - Intronic
1029701453 7:102249042-102249064 AGGGGCCGCGGCCCTGGGGCGGG + Exonic
1029896561 7:103989874-103989896 AGGGGCGCCCGCCGGGGAGCGGG + Intergenic
1032344846 7:131107964-131107986 AGTGGGCGACGCCGGGGGGCAGG - Intergenic
1032442555 7:131953201-131953223 AGGGGCTGCAGATGGGGAGCAGG + Intergenic
1032787416 7:135211662-135211684 CGGGGCCTCGGGCGGGGAGCCGG - Intergenic
1034449953 7:151131992-151132014 AGGGACTGCCGACGGGGACCAGG + Intronic
1034470453 7:151251887-151251909 GCGGGCGGCGGCCGGGGAGCTGG + Intronic
1035457113 7:159015866-159015888 AGGGGCCGCCCCCGGGCGGTGGG + Intergenic
1035537466 8:403274-403296 AGGGGCTGCAGCCGGTCAGCTGG + Intergenic
1035741395 8:1930735-1930757 AGGGGCCGTCCCCGTGGAGCAGG - Intronic
1036184333 8:6611502-6611524 AGGGCCCGGGGCCGGGGAGCAGG + Intronic
1038462465 8:27728558-27728580 AGGGGCCGTCGCTGGGGAAGAGG + Intergenic
1040080347 8:43277288-43277310 CGGCGCCGCCACCTGGGAGCCGG + Intergenic
1041281140 8:56211713-56211735 GCGGGCTGCCGCCGGGGAGCGGG + Intronic
1044343159 8:91070685-91070707 CCGCGCCGCCGCCGGGGTGCAGG + Intronic
1044430711 8:92103328-92103350 CCGGGCGTCCGCCGGGGAGCAGG + Intergenic
1044819357 8:96145295-96145317 AGGGGGCGCCGCCGGCCGGCTGG - Exonic
1045277736 8:100722324-100722346 AGGCGCCGCGGCCGGGGAAGCGG + Exonic
1047961697 8:130016178-130016200 AGGGGGCGCCGCCGTGGTGGGGG - Intronic
1049105337 8:140609069-140609091 AGGGGCCTCAGCGGGGGAGCAGG + Intronic
1049109348 8:140634096-140634118 AGGGGCCGCAGTCCTGGAGCAGG - Intronic
1049427069 8:142542422-142542444 GGGGCCCGCCGCTGGGGGGCTGG - Exonic
1049620942 8:143598015-143598037 CGGGGCCGCGGCCCGGGCGCGGG - Exonic
1049673199 8:143878620-143878642 AGGGGCGGCGGCTGGGCAGCCGG + Intergenic
1049773539 8:144394577-144394599 AGCGGGCGCGGACGGGGAGCCGG + Intronic
1049788489 8:144462537-144462559 CGGGGCGGCCGCCGGGCAGGCGG - Intronic
1049975945 9:861630-861652 AGGGGCAGCGGCCGGGCAGAGGG + Intronic
1053198437 9:36136977-36136999 GGAGGCCCCCGCCGGAGAGCCGG + Intronic
1054808301 9:69413290-69413312 GTGGGCAGCCTCCGGGGAGCAGG - Intergenic
1057225292 9:93289660-93289682 AGGGGCCGGAGCCCGGGCGCAGG + Intronic
1057443686 9:95099367-95099389 AGGGGCAGCCGCAGGGAGGCAGG - Exonic
1059344260 9:113617308-113617330 AGGGGCTGCTGCCAGGCAGCGGG - Intergenic
1060400316 9:123344747-123344769 AGGGGCTGCTGCTGGGGAGAGGG + Intergenic
1060481197 9:124017742-124017764 AGGGGGCGCCGTCGGGGCGCCGG + Intronic
1060522318 9:124300783-124300805 AAGGGCCACCGCAGGGGAGGGGG + Intronic
1060916320 9:127393185-127393207 AGGGGCTGCTGCCGGAGACCGGG - Exonic
1060970569 9:127735180-127735202 CGCGGCCGCCGCCTGGGACCTGG - Exonic
1061293715 9:129666169-129666191 CGGGGCCGGGGCCGGGGCGCGGG + Intronic
1061544983 9:131299284-131299306 AGGGGCAAGAGCCGGGGAGCTGG - Intronic
1061559676 9:131394349-131394371 CGCGGCCGCCGCCGGGGGCCCGG + Intronic
1062100355 9:134724803-134724825 AGGGGCCTCGGCGGGGGAGGTGG + Intronic
1062162397 9:135087623-135087645 GGGGGCCGCGGCCGGGAGGCGGG - Intronic
1062323812 9:136003273-136003295 AGGGGTGGGCACCGGGGAGCTGG + Intergenic
1062363747 9:136199250-136199272 AGGGGGCGCCGGCGGAGGGCGGG + Intronic
1062432736 9:136533193-136533215 AGGGGCTGCACCCCGGGAGCTGG + Intronic
1062621234 9:137423376-137423398 AGGGGGCGCCGCGGGGCAGCGGG + Exonic
1203775683 EBV:71898-71920 AGTGGCCGGGGCCGTGGAGCCGG - Intergenic
1189160292 X:38803779-38803801 AGTGGCCGCGGCCGGGAAACAGG - Exonic
1189320356 X:40083707-40083729 TGGGACCTCCGCCGAGGAGCGGG - Intronic
1190327217 X:49213974-49213996 AGGGGGCGCCGGAGGGGGGCAGG + Intronic
1191717767 X:64205109-64205131 AGGGGCGGCAGCCAGGCAGCCGG + Intronic
1194765520 X:97843248-97843270 AGTGGCCCCTGCCGGGGAGGTGG - Intergenic
1195599207 X:106726915-106726937 TGGGGCCGCCGCCTGGGGCCGGG + Exonic
1195979026 X:110558662-110558684 TGGGGCGGCCGCCGGGAAGAGGG + Intergenic
1198815063 X:140580688-140580710 AGGGGCCTGGGCCGGGGTGCAGG + Intergenic