ID: 1008653206

View in Genome Browser
Species Human (GRCh38)
Location 6:53584750-53584772
Sequence GCTTCCTAGAATATATCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008653206_1008653207 -5 Left 1008653206 6:53584750-53584772 CCAAGGGATATATTCTAGGAAGC 0: 1
1: 0
2: 1
3: 13
4: 119
Right 1008653207 6:53584768-53584790 GAAGCCATAATTATAGTCCTTGG No data
1008653206_1008653209 10 Left 1008653206 6:53584750-53584772 CCAAGGGATATATTCTAGGAAGC 0: 1
1: 0
2: 1
3: 13
4: 119
Right 1008653209 6:53584783-53584805 GTCCTTGGCTGTAAATCCATTGG 0: 1
1: 0
2: 1
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008653206 Original CRISPR GCTTCCTAGAATATATCCCT TGG (reversed) Intronic
906093667 1:43204911-43204933 GCTTCCTAGGAGATGCCCCTGGG + Intronic
906144277 1:43550612-43550634 CCCTCCTAGAACATAACCCTGGG - Intronic
909072266 1:71010071-71010093 CCCTCCTAAAATATATCCCCTGG + Intronic
909608010 1:77526130-77526152 GTTACTTAGAATGTATCCCTAGG - Intronic
909821070 1:80061827-80061849 TATTCCTAGAATATGGCCCTTGG + Intergenic
918537805 1:185593822-185593844 GCTTACTAGAAGAAAACCCTAGG + Intergenic
922050029 1:221979899-221979921 GCTTCATAAAATAGAGCCCTAGG + Intergenic
923223259 1:231915456-231915478 GCTTCCCAGAATACATCTGTTGG - Intronic
923928391 1:238662745-238662767 TCTTCCTAGAATATATTAGTGGG - Intergenic
1064030873 10:11881832-11881854 TCTGCCTAGAATATTCCCCTTGG - Intergenic
1066573947 10:36804740-36804762 AGTTTCTAAAATATATCCCTTGG - Intergenic
1067218326 10:44322292-44322314 TCTTCCTTGAATATCTGCCTTGG - Intergenic
1069698641 10:70405759-70405781 CCCTCCTAGATTTTATCCCTTGG - Intronic
1072791991 10:98324784-98324806 GCTTCTTAGAATATAGGCCTGGG - Intergenic
1075525869 10:123186294-123186316 GCTTCCAAAACTATTTCCCTGGG - Intergenic
1077272737 11:1689456-1689478 GCTTCCTGGAATACAGGCCTGGG - Intergenic
1078372012 11:10755841-10755863 TATGCCTAGAATATATCTCTTGG + Intronic
1078814710 11:14808126-14808148 GTTTCCTAGAAGTCATCCCTGGG - Intronic
1080810752 11:35701954-35701976 GCTTACTACACTATAACCCTGGG + Intronic
1087883024 11:103441247-103441269 GCTTCCTTGCACATATCCCGGGG - Intronic
1090056000 11:123425647-123425669 GTTTCCGAGAATAGAGCCCTGGG - Intergenic
1092197673 12:6559574-6559596 GCTTACTGGGATATAACCCTGGG - Intronic
1094014103 12:25843168-25843190 GCTTACTAGAAGAGATCCCTGGG - Intergenic
1096346967 12:50857308-50857330 GCTTCCTAGAATTTATCCCAAGG - Intronic
1097583841 12:61491564-61491586 GATTCCTAGTATATTTCACTGGG + Intergenic
1104406118 12:128518259-128518281 GACTCCTAGAATATATATCTAGG - Intronic
1106544009 13:30714935-30714957 GGTTCTGAGAATCTATCCCTTGG + Intronic
1106671413 13:31909761-31909783 GCTTCGTAGAAAATTTCCATGGG - Intergenic
1106987826 13:35376624-35376646 GCCTCCTAGAGAATATTCCTTGG - Intronic
1108433781 13:50381257-50381279 TCTTCCTAAAATATGTCCTTTGG - Intronic
1108833721 13:54513517-54513539 GCTTCATAGAATTCATCCCTTGG - Intergenic
1110032902 13:70639397-70639419 GCTTCCTAGAAATTACTCCTGGG - Intergenic
1112850593 13:103701308-103701330 GCTTCCTACTTAATATCCCTTGG + Intergenic
1115386851 14:32807473-32807495 GCTTCCTAAAACAAATCCTTTGG - Intronic
1115779123 14:36749888-36749910 TCTTCATAGAATGGATCCCTTGG + Intronic
1120334563 14:83137880-83137902 GTTTCCTAGAATATATCTATAGG - Intergenic
1121648613 14:95538656-95538678 CCTCTCTAGAATATATACCTAGG - Intronic
1125175987 15:36822330-36822352 GCTTTCTAGAATAGAGCCCTTGG + Intergenic
1125258629 15:37796854-37796876 GCTTCTTAGAAGTTATCCCCCGG + Intergenic
1126422716 15:48491769-48491791 CCTGCCTAGAGTATATCCCTTGG - Intronic
1131856880 15:96606477-96606499 GTTTGCTGGAATATGTCCCTGGG - Intergenic
1139307458 16:65999327-65999349 GCCTCCTAGAATATGTCTCTGGG - Intergenic
1143223062 17:5278736-5278758 TTTTCCTAAAATATATTCCTAGG + Intergenic
1144598439 17:16591222-16591244 GCTTCTAAGAATTTATCCTTGGG - Intergenic
1149166892 17:53762684-53762706 GCTTTCTAGAATTTCTCCTTAGG + Intergenic
1154128071 18:11711883-11711905 GCTTCCCAGAATCTATAGCTAGG - Intronic
1154456876 18:14537042-14537064 GCCTCCTAAAATTTATCTCTAGG + Intronic
1156634737 18:39013355-39013377 GCTTCCTTTAATATATCTCGGGG + Intergenic
1157172184 18:45417874-45417896 GCTTCCTAGAAGGTATGACTAGG - Intronic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1160520104 18:79502965-79502987 GTTTCCTTGAATACATACCTAGG - Intronic
1163083572 19:14962211-14962233 GCTTCCTGGAAAATGTCACTCGG - Exonic
1164895100 19:31869732-31869754 GCTTCTTGGAATATGTGCCTGGG - Intergenic
1165024735 19:32951873-32951895 GCTTACTACAATATTTCCCTTGG - Intronic
1167255023 19:48422123-48422145 GCATCCCAGAAAATATCCCAAGG - Intronic
926000391 2:9326896-9326918 TCTTCTTAGAATAAATTCCTGGG + Intronic
928210216 2:29318499-29318521 GTTTCCTCAAAGATATCCCTAGG - Intronic
932296791 2:70630982-70631004 GCTTCCTACAATGTATTTCTTGG - Intronic
933198190 2:79416786-79416808 GCTGCCTAAAAAATTTCCCTAGG - Intronic
940538101 2:154972249-154972271 GCTTCATGGAATATATCTTTCGG + Intergenic
942128979 2:172858765-172858787 TCTTCTTAGATTATATCACTTGG - Intronic
944697681 2:202217624-202217646 GCTCCCTTGGATATATACCTAGG - Intronic
1172135783 20:32685801-32685823 ATTTCCTAGAAAATACCCCTGGG - Intergenic
1175973960 20:62701067-62701089 GTTTCCTAGAAATTATTCCTGGG - Intergenic
1176817284 21:13616284-13616306 GCCTCCTAAAATTTATCTCTAGG - Intronic
1179012905 21:37570161-37570183 CCTTCCTAGAACCTACCCCTAGG + Intergenic
1182935355 22:34216947-34216969 GCTTCCTTAAATTTAGCCCTAGG - Intergenic
1184388606 22:44190341-44190363 ACTTCTTAGAATATAGCCCAGGG - Intronic
950153572 3:10706976-10706998 GCTTCCTAGAACATTAGCCTTGG - Intronic
952921282 3:38285778-38285800 GCTCCCTAGAGTATATACCTGGG + Intronic
953244549 3:41178656-41178678 GCCTCCAGGAATATACCCCTGGG - Intergenic
953527284 3:43703062-43703084 ACTTCATAGCATATATCCCAGGG + Intronic
955300973 3:57778940-57778962 ATTTCCTAGAGTATATACCTAGG - Intronic
956248353 3:67209525-67209547 ACTTCCTAGAATGTCTTCCTTGG - Intergenic
956637460 3:71380449-71380471 GCTTCCCAGAAAATATTGCTTGG + Intronic
960224678 3:115156060-115156082 GCTTCATAGAATATCCCCCAGGG + Intergenic
960629377 3:119714041-119714063 ATTTCCTAGAATAAATTCCTAGG + Intronic
961418182 3:126777271-126777293 CCTTCCTAAAATGTATGCCTGGG - Intronic
962331373 3:134481737-134481759 GCTTCATATAACATATACCTAGG - Intronic
966149449 3:176850588-176850610 GCTTTTTAGAAGATATCCCTAGG - Intergenic
967371592 3:188752705-188752727 GTTTCCTAGAATATATCTCCTGG + Intronic
968574444 4:1358573-1358595 GCTTCCCAGAATAGATGCCGTGG + Intronic
969100054 4:4762042-4762064 TCATCCTCGAAAATATCCCTGGG - Intergenic
969464706 4:7349451-7349473 GCTGCCTAGACTTTATCCCCAGG + Intronic
971242207 4:24899111-24899133 TCTTCCTAGAAGATATTCCAGGG + Intronic
971928347 4:33044523-33044545 ACTTCCTAAAATGTACCCCTGGG + Intergenic
972151558 4:36097692-36097714 GCATCCTAGGATTTATCTCTGGG - Intronic
974198885 4:58613084-58613106 CTTTCCTAAAATATATCCTTTGG + Intergenic
976169602 4:82289335-82289357 CTTTCCTAGAAAATATCACTGGG + Intergenic
976650840 4:87432838-87432860 GATTCCAAGAATGTCTCCCTTGG + Intronic
977084531 4:92576515-92576537 CCTTCCTAGGAGATGTCCCTAGG - Intronic
977360975 4:96003997-96004019 GCTTCATTGATTATTTCCCTTGG + Intergenic
978643120 4:110895185-110895207 GATTCTTAGAATTCATCCCTTGG + Intergenic
980251680 4:130323887-130323909 GTTTCTCAGAATGTATCCCTCGG - Intergenic
980330935 4:131410312-131410334 AATTTCTAGAATATATCTCTAGG - Intergenic
983736073 4:171062539-171062561 GATTCCTAGATTATAGCCCTTGG + Intergenic
984932541 4:184859910-184859932 ACTGCCTAAAATAGATCCCTAGG + Intergenic
986786517 5:11119400-11119422 GCTTCCTAGATAATATAACTAGG + Intronic
994745045 5:103667507-103667529 GCTTCCTATAATATCTAGCTAGG + Intergenic
998864001 5:146476609-146476631 TATTCCAAGAATATATTCCTGGG + Intronic
999279363 5:150354843-150354865 GCTTTCTAAAATGTCTCCCTTGG + Intergenic
1000480328 5:161766146-161766168 GATTCCTAGAGTATTTCCCATGG + Intergenic
1001182724 5:169535790-169535812 GCTTTGTTGAATATCTCCCTTGG - Intergenic
1005843332 6:29758879-29758901 GCTTCCTGAAATATGACCCTTGG + Intergenic
1007852110 6:44813080-44813102 TATTCCTAGAAAATATCCCTAGG - Intronic
1008653206 6:53584750-53584772 GCTTCCTAGAATATATCCCTTGG - Intronic
1013975620 6:116074923-116074945 GCTTCCCAGATTGTAACCCTAGG - Intergenic
1014879539 6:126706066-126706088 AATTCCTAGAAAATATGCCTAGG + Intergenic
1016252347 6:142059226-142059248 GTTTCTTAGAATATATCATTTGG - Intronic
1016721324 6:147302433-147302455 CCTTCCTACAATATATCTCCTGG - Intronic
1017287292 6:152690584-152690606 GTTTCTTAGAATTTATCTCTGGG + Intergenic
1018484031 6:164222067-164222089 GCTACAAAGAATATAGCCCTGGG - Intergenic
1019009294 6:168828950-168828972 GCTTCCTGGAGTGTATTCCTAGG + Intergenic
1028174288 7:87635162-87635184 GGTTTATAAAATATATCCCTGGG + Intronic
1030016703 7:105229858-105229880 GATTCCTGGACTAGATCCCTGGG - Intronic
1032779441 7:135151923-135151945 GCTTCCTAGAGTTCATCTCTGGG + Intronic
1035818844 8:2569681-2569703 GCTTCCTGGTATAAAGCCCTAGG - Intergenic
1036858537 8:12323073-12323095 GCTTCTGAGAATATATTCCAGGG - Intergenic
1037502502 8:19499175-19499197 GCTTCCTAGAAGATATGGGTCGG - Intronic
1039363215 8:36902630-36902652 GCTTCCTAGACACTCTCCCTAGG - Intronic
1040659895 8:49559312-49559334 GCATGATAGAATATATCCTTGGG + Intergenic
1041382701 8:57267939-57267961 TCTTCTTAGAATAAATTCCTGGG + Intergenic
1042344916 8:67717643-67717665 GCCTCCCAAAAGATATCCCTGGG + Intronic
1046476250 8:114748050-114748072 GCTTCCCAGAACCTATCACTGGG - Intergenic
1049102475 8:140589444-140589466 GCTTCCTAGGAGACAGCCCTGGG - Intronic
1052534839 9:29733372-29733394 GCTTCTTTCAATATAGCCCTTGG - Intergenic
1061190294 9:129078877-129078899 GCTTCTCAGAATAGTTCCCTGGG - Intergenic
1203530079 Un_GL000213v1:133213-133235 GCCTCCTAAAATTTATCTCTAGG + Intergenic
1187744948 X:22399122-22399144 GTTCCCTAGAATATAGCCCCTGG - Intergenic
1192633384 X:72793744-72793766 GCTTCCTAGACCAGAGCCCTGGG - Intronic
1192648325 X:72927057-72927079 GCTTCCTAGACCAGAGCCCTGGG + Intronic
1193781056 X:85701724-85701746 GCTTCATAGAATGTAGCCCAAGG - Intergenic
1199296987 X:146170549-146170571 TCTTCCTAGAATAAATACCCAGG - Intergenic
1199305015 X:146257682-146257704 ACTTCTTAGAATATACCCCAAGG + Intergenic