ID: 1008656387

View in Genome Browser
Species Human (GRCh38)
Location 6:53618363-53618385
Sequence GAAAGTGATGTGTTCACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008656387_1008656394 20 Left 1008656387 6:53618363-53618385 CCACCTGTGAACACATCACTTTC No data
Right 1008656394 6:53618406-53618428 CCTTCTGACCTTGAGCCAGTGGG No data
1008656387_1008656392 19 Left 1008656387 6:53618363-53618385 CCACCTGTGAACACATCACTTTC No data
Right 1008656392 6:53618405-53618427 TCCTTCTGACCTTGAGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008656387 Original CRISPR GAAAGTGATGTGTTCACAGG TGG (reversed) Intergenic
No off target data available for this crispr