ID: 1008657027

View in Genome Browser
Species Human (GRCh38)
Location 6:53625942-53625964
Sequence GAATAGTATATTAAGTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008657022_1008657027 20 Left 1008657022 6:53625899-53625921 CCAATAAAACTAAAACTGTACTG No data
Right 1008657027 6:53625942-53625964 GAATAGTATATTAAGTTGGAGGG No data
1008657021_1008657027 28 Left 1008657021 6:53625891-53625913 CCACACAGCCAATAAAACTAAAA No data
Right 1008657027 6:53625942-53625964 GAATAGTATATTAAGTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008657027 Original CRISPR GAATAGTATATTAAGTTGGA GGG Intergenic
No off target data available for this crispr