ID: 1008659443

View in Genome Browser
Species Human (GRCh38)
Location 6:53651438-53651460
Sequence TCCTGATGGCTTTAAATTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008659443 Original CRISPR TCCTGATGGCTTTAAATTCC TGG (reversed) Exonic