ID: 1008660431

View in Genome Browser
Species Human (GRCh38)
Location 6:53662207-53662229
Sequence CTGCTGTCATTTAGGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 261}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008660431_1008660437 4 Left 1008660431 6:53662207-53662229 CCATTTTTCCTAAATGACAGCAG 0: 1
1: 0
2: 1
3: 29
4: 261
Right 1008660437 6:53662234-53662256 GGTTCTCCCTGGCTGCCTAAGGG 0: 1
1: 0
2: 1
3: 12
4: 179
1008660431_1008660439 6 Left 1008660431 6:53662207-53662229 CCATTTTTCCTAAATGACAGCAG 0: 1
1: 0
2: 1
3: 29
4: 261
Right 1008660439 6:53662236-53662258 TTCTCCCTGGCTGCCTAAGGGGG 0: 1
1: 0
2: 0
3: 17
4: 189
1008660431_1008660445 29 Left 1008660431 6:53662207-53662229 CCATTTTTCCTAAATGACAGCAG 0: 1
1: 0
2: 1
3: 29
4: 261
Right 1008660445 6:53662259-53662281 GCTCTAATATGTTACCTTTTGGG No data
1008660431_1008660440 7 Left 1008660431 6:53662207-53662229 CCATTTTTCCTAAATGACAGCAG 0: 1
1: 0
2: 1
3: 29
4: 261
Right 1008660440 6:53662237-53662259 TCTCCCTGGCTGCCTAAGGGGGG 0: 1
1: 0
2: 2
3: 26
4: 177
1008660431_1008660435 -7 Left 1008660431 6:53662207-53662229 CCATTTTTCCTAAATGACAGCAG 0: 1
1: 0
2: 1
3: 29
4: 261
Right 1008660435 6:53662223-53662245 ACAGCAGGCTTGGTTCTCCCTGG 0: 1
1: 0
2: 0
3: 23
4: 212
1008660431_1008660436 3 Left 1008660431 6:53662207-53662229 CCATTTTTCCTAAATGACAGCAG 0: 1
1: 0
2: 1
3: 29
4: 261
Right 1008660436 6:53662233-53662255 TGGTTCTCCCTGGCTGCCTAAGG 0: 1
1: 0
2: 2
3: 16
4: 223
1008660431_1008660438 5 Left 1008660431 6:53662207-53662229 CCATTTTTCCTAAATGACAGCAG 0: 1
1: 0
2: 1
3: 29
4: 261
Right 1008660438 6:53662235-53662257 GTTCTCCCTGGCTGCCTAAGGGG 0: 1
1: 0
2: 2
3: 9
4: 125
1008660431_1008660444 28 Left 1008660431 6:53662207-53662229 CCATTTTTCCTAAATGACAGCAG 0: 1
1: 0
2: 1
3: 29
4: 261
Right 1008660444 6:53662258-53662280 GGCTCTAATATGTTACCTTTTGG 0: 1
1: 0
2: 0
3: 9
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008660431 Original CRISPR CTGCTGTCATTTAGGAAAAA TGG (reversed) Intronic
903646393 1:24898653-24898675 CTGCTGTCTTTTGGGTAAAAGGG + Intergenic
905142176 1:35856168-35856190 ATGCTGTCATTTTGGACAAAAGG + Exonic
906813436 1:48852573-48852595 ATTCTCTAATTTAGGAAAAAAGG - Intronic
908117211 1:60952100-60952122 CTGCTGTCAATTTAGATAAATGG - Intronic
908497772 1:64712261-64712283 CTGATGTAATTTAGGACAGAGGG - Intergenic
908577150 1:65472293-65472315 GGGCTGTCATTTGGGAAAACGGG + Intronic
909394641 1:75156047-75156069 CTACTGGTATTTAGGACAAAAGG - Intronic
910817673 1:91309922-91309944 CTACTATCATTTAAAAAAAAAGG + Intronic
912695510 1:111838775-111838797 CTGTTGACACTTGGGAAAAAGGG + Intronic
913126838 1:115798806-115798828 CTGTTTTCCTTTAGGAATAAAGG - Intergenic
913574487 1:120157190-120157212 ATGCTGTCAAAGAGGAAAAAAGG + Exonic
914295756 1:146321994-146322016 ATGCTGTCAAAGAGGAAAAAAGG + Intergenic
914556795 1:148772792-148772814 ATGCTGTCAAAGAGGAAAAAAGG + Intergenic
914616039 1:149357438-149357460 ATGCTGTCAAAGAGGAAAAAAGG - Intergenic
915957939 1:160238838-160238860 CAGCTGTCATGTAAGAAAAGGGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918867913 1:189926917-189926939 CTGCTGTCATTTATGGAGGATGG - Intergenic
918890623 1:190262458-190262480 GTGCTGTAACTAAGGAAAAAAGG - Intronic
921019205 1:211221056-211221078 CTGCAGTGATCCAGGAAAAAAGG - Intergenic
921190448 1:212703712-212703734 CTTCTCTCTTTTAGGAAAATTGG + Intergenic
921271791 1:213476282-213476304 CCACTATCATTTAGGAAACAAGG - Intergenic
921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG + Intronic
922039878 1:221886485-221886507 CTGATGTCAATTTGGAAAAGGGG + Intergenic
923399142 1:233599557-233599579 GTGAAGTCATTTAAGAAAAAAGG + Intergenic
924444623 1:244117646-244117668 CTGCTGTCTTTTACAAAAACTGG + Intergenic
924939760 1:248804869-248804891 CTGCTGTGGTTTAGGGAAGAAGG - Intergenic
1063350421 10:5349162-5349184 CTGCTGTAAGTTAGGAAAACAGG - Intergenic
1063669023 10:8084782-8084804 CAGCTGTAATTTAGTAAGAAGGG + Intergenic
1064222356 10:13452256-13452278 ATGCTGTCATATATGAAAACCGG - Intronic
1064343906 10:14513278-14513300 CTTCTTTCATTTAGGAAACTTGG - Intergenic
1064611638 10:17109428-17109450 CTGCTCTGATTTAGGAAATAAGG - Intronic
1064949575 10:20833426-20833448 AGCCTGTCATTTAGGCAAAATGG + Intronic
1065672125 10:28131318-28131340 CTGTTGACATTTATGAAAGAAGG - Intronic
1067026833 10:42849772-42849794 ATGCTGTCATTTAGGCAATGTGG + Intergenic
1067975570 10:51021506-51021528 GTGCTGTCTTTTAGAAAAATGGG - Intronic
1068621398 10:59186927-59186949 CTGCATTCAATTAGGAAAAGAGG - Intronic
1068995559 10:63198707-63198729 AGGTTGTCATTTAGTAAAAACGG - Exonic
1069326969 10:67243042-67243064 TTGCTGTCATCTAAGAAAACAGG - Intronic
1069336097 10:67352612-67352634 CTGCTAACATACAGGAAAAATGG - Intronic
1070121850 10:73585255-73585277 ACACTGTCAGTTAGGAAAAAAGG - Intronic
1070945825 10:80390819-80390841 CAGCTTTCTTTTAAGAAAAACGG - Intergenic
1071106586 10:82104438-82104460 AAGCTGTCATTTAGGAAGCAGGG + Intronic
1073809200 10:107134178-107134200 CTGATGTCAGGAAGGAAAAAAGG + Intronic
1074181754 10:111071426-111071448 GTGTTATCAATTAGGAAAAATGG + Intergenic
1075433423 10:122410715-122410737 ATACTGTAATTTAAGAAAAATGG + Intronic
1075437461 10:122455804-122455826 ATGCTGCCATTTAGGCAAAATGG - Intronic
1076002978 10:126927090-126927112 CTCCAGTCATTGAGGAAATAAGG + Intronic
1076490134 10:130854523-130854545 GTACTGTCATTTAGAAATAAAGG - Intergenic
1076499742 10:130928331-130928353 ATGCTGTCATTTACTAGAAATGG + Intergenic
1078555154 11:12319195-12319217 CAGATGTCATGTAGTAAAAATGG + Intronic
1078858644 11:15227206-15227228 CTGCTGTCATCTTTGAAGAAAGG + Intronic
1079639034 11:22781147-22781169 CTGCTGTCCTTTGGCAAACAAGG + Intronic
1079863739 11:25708364-25708386 CTGCTGCCATCTACAAAAAATGG + Intergenic
1080219520 11:29884891-29884913 CTACTATGATTTAGTAAAAATGG + Intergenic
1080611836 11:33911064-33911086 CTACTGTAAATTAGGAAGAAGGG - Intergenic
1081026452 11:38020278-38020300 CTGTAGTCATTTAGGAAAGCAGG - Intergenic
1086340470 11:85843442-85843464 CTGGTGTCATTTACTAAATACGG + Intergenic
1087166217 11:95006218-95006240 CTGCTTTCATTCAGAAAATATGG - Intergenic
1088001541 11:104887750-104887772 CTCCTATAATTTAGAAAAAAAGG + Intergenic
1088726083 11:112636468-112636490 CTGCTTTTATGAAGGAAAAAAGG + Intergenic
1089643536 11:119863463-119863485 CTCCTCTCCTCTAGGAAAAAGGG - Intergenic
1091433759 12:458097-458119 CTGCAGTTCTTTAGCAAAAAGGG - Intergenic
1093948227 12:25134936-25134958 GTATTGCCATTTAGGAAAAATGG + Intronic
1094274129 12:28650052-28650074 ATCCTGTCATTTAGGACAACAGG - Intergenic
1095249783 12:39964866-39964888 CTGCTTTCAGTTAGTAAAGAAGG + Intronic
1095375882 12:41528049-41528071 CTGTAGCCATTTAGCAAAAAGGG + Intronic
1096205196 12:49715650-49715672 CTTCTATCATGTGGGAAAAATGG - Intronic
1098177790 12:67810963-67810985 CTGCTTTCATGGAGGAAAACAGG + Intergenic
1098717051 12:73842590-73842612 CTGGTGTCATTTACTAAGAAAGG - Intergenic
1098905678 12:76159804-76159826 TTGGTATCATTTAGGAAGAATGG - Intergenic
1099323596 12:81182291-81182313 ATGCTGTCCTTCAGGAAAGAAGG + Intronic
1100135762 12:91551549-91551571 TTGCAGTCATTTAAGAGAAAAGG + Intergenic
1101778866 12:107817739-107817761 CTGCTGAGATTTGGGAAACAAGG - Intergenic
1103690442 12:122768893-122768915 TTGATGTCATTCAGGAAAAATGG + Exonic
1105510340 13:21046738-21046760 GTGGTGTCTTTTAGGAAAATTGG - Intronic
1105533455 13:21241961-21241983 CTTCTATTATTCAGGAAAAAAGG + Intergenic
1106010758 13:25819736-25819758 CTGCTTTCATTTATGAGAAGTGG + Intronic
1107014811 13:35699648-35699670 GTGTTGTCATTAAGGAAAAAGGG - Intergenic
1108456294 13:50617326-50617348 CTGCTGCCTTTTAGCAAAGATGG - Intronic
1109096299 13:58121099-58121121 CTGGAGTAATTTAGAAAAAAAGG + Intergenic
1110959244 13:81599823-81599845 CTGCCACCATTTGGGAAAAATGG + Intergenic
1111179699 13:84647404-84647426 CTTCTAACATTTAGGAGAAAAGG + Intergenic
1112921381 13:104616804-104616826 CTCCTGCAATTTAGGAAAGAAGG + Intergenic
1113317968 13:109204230-109204252 GTTGTGTCATTTAGGAAACATGG + Intronic
1113373097 13:109740429-109740451 CTGCTGTTATAAAGGAAAAGAGG + Intergenic
1116419821 14:44720031-44720053 GGGCTGTCTTTTAGGAAAAAAGG - Intergenic
1116891180 14:50270301-50270323 ATGAAGTCATTTAGGAAATAGGG - Intronic
1117511068 14:56451606-56451628 CTGCTGCCATTTAGAAACATTGG + Intergenic
1118013487 14:61634480-61634502 CTGCTTTAATTTAGAAAATAAGG + Intronic
1118787235 14:69056051-69056073 CTGTTTTCATTTGGGAAAAGTGG - Intronic
1120705765 14:87743997-87744019 CTGCAGTCATTTTAGAAATAAGG - Intergenic
1123904301 15:24906885-24906907 CTGCTGTCCCTTAGGAGAAGAGG + Intronic
1124608760 15:31193277-31193299 CTGCTTTCCCTCAGGAAAAATGG + Intergenic
1126431880 15:48594474-48594496 CTGCTCCCCTTCAGGAAAAAGGG - Intronic
1127204875 15:56705162-56705184 TTGATGGCATTTAGGAAAATGGG - Intronic
1127481587 15:59382845-59382867 CTGATGCCATGTAGGAAACATGG + Intronic
1128286022 15:66437863-66437885 CTGCTCTCATTGAGGAAAGAAGG - Intronic
1128287912 15:66453689-66453711 CTTCTGTCCTTGAGGAAAAGTGG + Intronic
1128485830 15:68086914-68086936 AAGCTGTCTTTCAGGAAAAAAGG + Intronic
1131031023 15:89186068-89186090 CTGCTCTAATTTGGGAGAAAAGG - Intronic
1131339896 15:91589049-91589071 CTACTGCCCATTAGGAAAAATGG + Intergenic
1132001920 15:98189107-98189129 TTACTGTCATTTTGGACAAATGG - Intergenic
1137295131 16:47085033-47085055 CTGCTGTCTTAGAGGATAAAAGG + Intronic
1138469873 16:57225645-57225667 CTGCTATCTTTAAGGAACAATGG - Intronic
1140217952 16:73023377-73023399 CTGCTGTCATCTAGACACAAGGG + Intronic
1141334820 16:83144852-83144874 CTGCTGTCTGTTAGGAGAGAAGG - Intronic
1142484665 17:238925-238947 CTGCTGTCATATATGAGCAATGG + Intronic
1143726194 17:8848289-8848311 ATGCTGTCTTTTAGGAAAAGAGG - Intronic
1143763784 17:9124153-9124175 CTGCTGATTTTTAAGAAAAATGG - Intronic
1143952181 17:10641969-10641991 CTGGTGTCCTTTAGGAAAATTGG + Intronic
1144261031 17:13521065-13521087 CTGCTGCCATGTAGAAAAAAGGG - Intronic
1145916330 17:28576174-28576196 CTGCAGTGATGTAGGAAAGAGGG + Intronic
1148237903 17:45981718-45981740 CTGGTTTCATTTACCAAAAAGGG + Intronic
1148534467 17:48427877-48427899 CTGTTGACAATTAGAAAAAATGG - Intronic
1149653369 17:58293268-58293290 CTGGTGTCATTTCAGAGAAATGG - Intergenic
1150220460 17:63493186-63493208 CTGGAGTCATTCAGGAAAATGGG + Intronic
1150648685 17:66995888-66995910 CTGATGGCAATAAGGAAAAATGG - Intronic
1154324802 18:13382175-13382197 CTACTTTGATTTTGGAAAAAAGG + Intronic
1155752499 18:29443821-29443843 CTGAATTCATTCAGGAAAAAAGG + Intergenic
1157969208 18:52247027-52247049 CTCCTGGCATTTAGCAACAAGGG - Intergenic
1158056170 18:53283855-53283877 CTGCTGTCTTTTATGAAGCAAGG - Intronic
1158319094 18:56243882-56243904 CTGCTGTCTTTTTGCAGAAAAGG - Intergenic
1158803436 18:60941396-60941418 GTGCTGTAGTTTAGAAAAAAAGG - Intergenic
1159913016 18:74164422-74164444 CTGCTGTCAGCTAGGAAATTAGG + Intergenic
1161930586 19:7336916-7336938 ATGCTGTCATTCAGGAAGACAGG - Intergenic
1164109836 19:22145799-22145821 GTGTTGTGATTCAGGAAAAAAGG + Intergenic
1164864279 19:31590952-31590974 CAGCTGTCCTTCAGGAAAGAGGG + Intergenic
1165185486 19:34017191-34017213 CTGCTGTCATACAGGACAAATGG - Intergenic
926673498 2:15598365-15598387 GTGCCGTCATTTATGAGAAATGG + Intronic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
931226848 2:60339219-60339241 AAGCTGTCATCTAGGAAGAAAGG + Intergenic
931774246 2:65526468-65526490 CTGTTGTCCTTTGGGAACAATGG + Intergenic
932059848 2:68485259-68485281 CTGATGTCATTAAAGACAAAAGG - Intronic
935483432 2:103621996-103622018 TAGCTGTCCTTTAGGAATAATGG + Intergenic
939418252 2:141929473-141929495 CTTCTGTCTTTTAAAAAAAATGG - Intronic
940100383 2:150030952-150030974 CTTCTTTCATTTAAGAGAAATGG - Intergenic
940807576 2:158205307-158205329 CTGTTGTCATTTACAGAAAAGGG + Intronic
941509509 2:166388136-166388158 ATGTTGTCATTTATGAAAAATGG + Intergenic
941704129 2:168639816-168639838 CTGCTGTCAGGTGGGACAAATGG + Intronic
941979979 2:171444729-171444751 TGGCTGTCCTTTAGGAAAAACGG + Intronic
942319353 2:174723046-174723068 CTGCTTAGACTTAGGAAAAATGG - Intergenic
944484190 2:200186537-200186559 TTGCTGTCATTTTGGATTAAGGG + Intergenic
944914341 2:204342365-204342387 CTGCTATAAATTAGGAGAAATGG + Intergenic
945727845 2:213494814-213494836 CTGGTGTCATTGAGGAGATAGGG - Intronic
945858779 2:215096919-215096941 CTAATGGAATTTAGGAAAAAGGG + Intronic
947483951 2:230529606-230529628 CGGCATTCATTTAGGAAAACAGG + Intronic
1170117139 20:12872633-12872655 CTGTTCTCATTCATGAAAAAAGG + Intergenic
1170136578 20:13080615-13080637 CTTTTGTCAGTTAGGGAAAAAGG - Intronic
1170383549 20:15789435-15789457 TTGCTGTCATATAAGAAAAATGG - Intronic
1171218595 20:23372889-23372911 TTGCTGTCGTTTGGAAAAAATGG + Exonic
1173401322 20:42728624-42728646 CAGCTGTCGTGTAGGAACAATGG - Intronic
1174747925 20:53082654-53082676 CAGCTGCCATTTTGGAGAAAGGG - Intronic
1174978869 20:55368975-55368997 GTTCTGTCATTTAGGAAAACAGG - Intergenic
1177935362 21:27338529-27338551 CTGATGTCCTTCAGAAAAAAAGG + Intergenic
1178272135 21:31200396-31200418 CTACATTCATTTAGGATAAAAGG - Intronic
1179460365 21:41530702-41530724 CTGCTGTCAGTGAGGGAAAGGGG + Intronic
1179914693 21:44468559-44468581 CTCATGTCATTTATTAAAAAGGG - Intergenic
1181429044 22:22866549-22866571 CTGATGTCATTCATGAAAATTGG + Intronic
1182045157 22:27268465-27268487 CTGCTCTCATTAAGGTCAAAAGG - Intergenic
949364644 3:3267697-3267719 CTGCTTACATTTGGGACAAAGGG + Intergenic
949750066 3:7341911-7341933 CTGCTGTCATTCAGAAGACAAGG + Intronic
949783172 3:7712513-7712535 CTACTGTAATTCAGGAAAGAGGG - Intronic
951355646 3:21663561-21663583 GTGTAGTCATTTAGGAATAAGGG + Intronic
951378948 3:21958678-21958700 CTGCAGTAATTTAGAAAAATAGG - Intronic
952277355 3:31890320-31890342 CTGCTGTGATTTAGGAAAGCTGG - Intronic
952337564 3:32417346-32417368 CTTCTTTCACTTAGGAAAAGGGG + Intronic
955006795 3:54976170-54976192 CTGCTGTCTTTTAGAAAGTAAGG + Intronic
956574195 3:70733333-70733355 ATGAAGTCATTTAAGAAAAATGG - Intergenic
957439319 3:80223196-80223218 CACCTTTCATTTAGGTAAAATGG + Intergenic
957634819 3:82768275-82768297 CTGGAGTAATTTAGAAAAAATGG + Intergenic
958634849 3:96730669-96730691 ATGCTGTCCTTTAGGGTAAAGGG + Intergenic
961911024 3:130316718-130316740 CTGCTGTCATATAGAAAAGAAGG + Intergenic
962235486 3:133703463-133703485 CTGCTTTCATTTATAAAAGAGGG + Intergenic
962453830 3:135547050-135547072 CTTGTGTGATTTAGGAAAGATGG + Intergenic
962899149 3:139742668-139742690 TTGCTTTCTTTTAGGAAAAGCGG + Intergenic
963626200 3:147677082-147677104 CTACTGTGATTTAGCAAAGAAGG - Intergenic
964046483 3:152333963-152333985 CTGCTCCCATTTTGGAAACAAGG - Intronic
964202453 3:154133319-154133341 GTGTTGTCATTTAGGAATAAAGG + Intronic
964333440 3:155629182-155629204 CTGATGTCATTCAGAAAAAATGG - Intronic
964507450 3:157415063-157415085 ATGGTGTCATTTATGAGAAAAGG - Intronic
968264867 3:197355156-197355178 CTGCTGTCATTTCAGGAATATGG + Intergenic
970633147 4:17976681-17976703 ATTTTGTCTTTTAGGAAAAATGG - Intronic
972583777 4:40418441-40418463 GTGCTGTCAGTTTGGAATAAAGG + Intergenic
973270266 4:48255316-48255338 CTGCTGGCATTTAGGAAAGGGGG - Intronic
976033686 4:80790248-80790270 CTGCTGTGAGCTAGGAAACATGG - Intronic
977465451 4:97378638-97378660 TTGTTGTCAGTTAAGAAAAAAGG - Intronic
977842311 4:101723356-101723378 CTACTTTCATTTAGAAATAAAGG + Intronic
978190505 4:105905479-105905501 ATGCCATCATTTATGAAAAAGGG - Intronic
979302703 4:119105816-119105838 TTCCTGTCATTCAGGAAGAAGGG + Intergenic
981612617 4:146611426-146611448 TAGCTGTCATTTTAGAAAAAAGG + Intergenic
981838007 4:149077914-149077936 CTGCTGTTTTTAAGGGAAAATGG - Intergenic
982546683 4:156741949-156741971 CACCTCTCATTTAGGTAAAAAGG + Intergenic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
985345473 4:189000615-189000637 TTGCGGTCATTTGGAAAAAAGGG + Intergenic
986317614 5:6601077-6601099 CTGCTTTACATTAGGAAAAATGG - Intronic
988396617 5:30704240-30704262 CAGCTGACACTTAGGGAAAATGG - Intergenic
990387014 5:55274946-55274968 CTGCTGTACTTTTGGTAAAATGG + Exonic
992356666 5:75992253-75992275 CTGCTTCCACTTAGGCAAAATGG - Intergenic
992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG + Intergenic
992996686 5:82340749-82340771 TTCCTGTCATTGAGGAAAACAGG + Intronic
993121554 5:83780604-83780626 CTGCTGTCATAGATGTAAAATGG - Intergenic
994110532 5:95998118-95998140 CTACAGTCATTTAAAAAAAAAGG - Intergenic
994382577 5:99088759-99088781 TTGCAGTCATTTTGGAAAATGGG - Intergenic
994840258 5:104914968-104914990 CTGCAGTTATATAGCAAAAAAGG + Intergenic
996329136 5:122311144-122311166 CTGATTTCATTTCGGAAATAAGG + Intergenic
996729968 5:126707460-126707482 CTGCAGTAATTGGGGAAAAAAGG + Intergenic
998440858 5:142160974-142160996 CTAATGACATTTAGGAAAGAAGG - Intergenic
999356959 5:150944323-150944345 CTGCTTTGGTTTAGGAAATAAGG - Intergenic
999704173 5:154256233-154256255 CTGCTGTCATGCAGGAATACAGG + Intronic
999936957 5:156497216-156497238 CTTCTGTTATTGAGGAAAGATGG + Intronic
1000873996 5:166612988-166613010 CTGCTGGCATTGAGGAAGCAAGG - Intergenic
1001673841 5:173496331-173496353 CTGCTGTCAGTTTGTGAAAAGGG + Intergenic
1001844154 5:174905482-174905504 CTGCTGTCATTTGGAGGAAAAGG - Intergenic
1001868962 5:175133649-175133671 CTTCTGTCATTTATGTAAGATGG - Intergenic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003388804 6:5694385-5694407 CTTCTATTATTCAGGAAAAAAGG - Intronic
1003826658 6:9960240-9960262 CAGCTGTCAGTTAGGAAACCAGG + Intronic
1005136168 6:22570903-22570925 CTTCAGACATTTAGGGAAAAGGG + Exonic
1007866876 6:44981051-44981073 CAGCTGGCATTTACGCAAAACGG - Intronic
1008125053 6:47658725-47658747 CTGTTAACATTTAGGATAAATGG - Intronic
1008161464 6:48081321-48081343 CTGCTCTGTTTTAGGAATAATGG + Intergenic
1008334150 6:50279968-50279990 CTTCTTGCACTTAGGAAAAATGG + Intergenic
1008412356 6:51194411-51194433 CTGCTGGAATTTTGAAAAAAAGG + Intergenic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1009749392 6:67863863-67863885 CTGATGTCAAATAAGAAAAATGG - Intergenic
1009820372 6:68792409-68792431 CTACTGTTATTTAGCAATAATGG - Intronic
1010285791 6:74076335-74076357 GTACTCTCATTTAGGAAAATAGG + Intergenic
1010760390 6:79715947-79715969 CTTTTGTCATTCAGGAAAATAGG - Intergenic
1011587475 6:88942293-88942315 ATACTGTCATTCAGAAAAAAAGG - Intronic
1013661602 6:112303309-112303331 GTGCAGTCACTTAGGAAAACAGG - Intergenic
1014489798 6:122047811-122047833 TTGCTGTCATTTCGGAAATATGG - Intergenic
1017787572 6:157769238-157769260 CTGCTGTCACTTAGCAATGAGGG - Intronic
1018446729 6:163865187-163865209 CTGCTGTTATTTAAACAAAATGG - Intergenic
1018463233 6:164018803-164018825 CTGCTGGAATTTAGGCAAGATGG - Intergenic
1021079499 7:16347286-16347308 CTTTAGTCACTTAGGAAAAAGGG - Intronic
1021548400 7:21842387-21842409 CTGCTGTACTTTAGGAAATTTGG + Intronic
1022130262 7:27398441-27398463 CTGCTGCCATTTATAACAAATGG + Intergenic
1023339313 7:39202766-39202788 TTGCTGTCATTTAATAACAAGGG - Intronic
1023509033 7:40930885-40930907 GTGCATTCATTTAGGAAAAGAGG - Intergenic
1027767366 7:82362548-82362570 CTGCAGTAATGGAGGAAAAAAGG + Intronic
1028417209 7:90594150-90594172 CTGATCTCATTTAAGAAAATTGG + Intronic
1028646128 7:93098679-93098701 CTGCTGGCATTGAGGAAATAAGG + Intergenic
1029456426 7:100674520-100674542 CAGCTTTCTTTTAGGCAAAATGG + Intronic
1029990383 7:104957782-104957804 CCGCTGTCACTTAGTAACAAGGG + Intergenic
1031152655 7:118072736-118072758 TTGGTGACATTTATGAAAAAGGG - Intergenic
1031249366 7:119359650-119359672 TTCATGGCATTTAGGAAAAATGG + Intergenic
1032947982 7:136873221-136873243 CTTCTCTCATTTAAGATAAATGG + Intronic
1034393562 7:150803419-150803441 CTGCCTTCATTTACGAGAAACGG + Exonic
1034637199 7:152576821-152576843 CTCCTGCCCTTAAGGAAAAAGGG + Intergenic
1035846948 8:2875316-2875338 CAGCTGTCAGTTAGAAATAAGGG + Intergenic
1038339257 8:26670566-26670588 CTACTGTCATCTAGGAGGAAAGG - Intergenic
1038355416 8:26824617-26824639 ATGCTGGCATTGAGCAAAAAGGG - Intronic
1039105250 8:33982887-33982909 CTTCTAACATTTAGGGAAAAAGG - Intergenic
1041889929 8:62857891-62857913 CTGTAGTCATTTAGAAGAAAGGG + Intronic
1044055351 8:87562942-87562964 ATGCTATCATTGAGGAAAACGGG - Intronic
1044064130 8:87678501-87678523 CTGCTCTCAGTAAGAAAAAAAGG + Intergenic
1045906366 8:107350169-107350191 TTGCTGTCATTTAGGAAACATGG - Intronic
1046333615 8:112754535-112754557 CTTTTGTCATTTAGGCAACAAGG + Intronic
1047680716 8:127251665-127251687 CTGCTGGCAGATAGAAAAAAAGG - Intergenic
1047705450 8:127494814-127494836 CTGTTTCCATTTTGGAAAAAGGG - Intergenic
1047790784 8:128201462-128201484 TTGCTTTCATTTTGGAAATAAGG + Intergenic
1048705753 8:137151400-137151422 CTGCTGTCAATCTGAAAAAATGG - Intergenic
1049153863 8:141055402-141055424 CTGCTGCCAATTAGGAAGCAAGG - Intergenic
1051083336 9:13318320-13318342 CAGCTGTCATATATGGAAAAAGG - Intergenic
1051800060 9:20922477-20922499 CTGCTTTCATTTGGTAAGAATGG - Intronic
1051851308 9:21512102-21512124 CTGCTGTCAGACAGGAAAGATGG + Intergenic
1051973092 9:22914297-22914319 TGGCTGGCTTTTAGGAAAAAGGG - Intergenic
1054929349 9:70619810-70619832 CTTCTTTCAGCTAGGAAAAATGG - Intronic
1056175261 9:84028616-84028638 ATGCTATCATTTTGGAAAACTGG - Intergenic
1056805928 9:89728878-89728900 CTGCAGTAATTTAGGGAAACAGG + Intergenic
1057462606 9:95277295-95277317 CTTTTCCCATTTAGGAAAAAAGG - Intronic
1057791939 9:98130437-98130459 CTTCTGTCTTAGAGGAAAAAGGG - Intronic
1058335549 9:103823846-103823868 ATGCAGTTATTTGGGAAAAATGG + Intergenic
1059113914 9:111583758-111583780 CTACTGTCAGATAGGAATAAAGG + Intronic
1059461585 9:114434223-114434245 CTGCTGTCATCTATGAAACACGG - Intronic
1060948554 9:127586001-127586023 CTACTAACATTTAGGAAAAGGGG + Intergenic
1185503345 X:615385-615407 CTGGTGTCTTTGGGGAAAAAGGG - Intergenic
1186235030 X:7498501-7498523 CTGCTCTCATTTTGGAAAGAAGG + Intergenic
1187017883 X:15348563-15348585 GTGCTGTCATTTGGTATAAATGG - Intronic
1187042030 X:15606853-15606875 CTTTTTACATTTAGGAAAAAAGG - Intergenic
1187146295 X:16640320-16640342 ATGGTTTCATTTAGGAAAAGAGG - Intronic
1188562595 X:31486380-31486402 ATGCTGTAAATTGGGAAAAATGG + Intronic
1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG + Intronic
1192262550 X:69514711-69514733 CTGCTGTTATGTATGTAAAATGG - Intronic
1194793951 X:98186795-98186817 ATGTTTTCATTTGGGAAAAAAGG + Intergenic
1195724810 X:107903630-107903652 CTGCTGTTCTTTTGGAAAGAGGG - Intronic
1196103155 X:111868596-111868618 CTGATTTCTTTTAGGAAACATGG - Intronic
1196115207 X:111991830-111991852 CTCCTGTGTATTAGGAAAAATGG - Intronic
1196676069 X:118421149-118421171 CTGCTTTGCTTTAGGGAAAAGGG + Intronic
1198634886 X:138686090-138686112 CTGCTAACTTTTAAGAAAAAAGG + Intronic
1198920863 X:141724930-141724952 CTGATGTCCTTTGGGAGAAATGG - Intergenic
1202091029 Y:21190444-21190466 CTGCTATCATTTGAAAAAAATGG + Intergenic