ID: 1008660823

View in Genome Browser
Species Human (GRCh38)
Location 6:53665793-53665815
Sequence CCGAGCCTGCGCTTTGGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008660818_1008660823 -5 Left 1008660818 6:53665775-53665797 CCCACTGGATAAGGCAGGCCGAG 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1008660823 6:53665793-53665815 CCGAGCCTGCGCTTTGGCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 147
1008660817_1008660823 -1 Left 1008660817 6:53665771-53665793 CCGTCCCACTGGATAAGGCAGGC 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1008660823 6:53665793-53665815 CCGAGCCTGCGCTTTGGCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 147
1008660814_1008660823 5 Left 1008660814 6:53665765-53665787 CCTTTGCCGTCCCACTGGATAAG 0: 1
1: 0
2: 1
3: 3
4: 53
Right 1008660823 6:53665793-53665815 CCGAGCCTGCGCTTTGGCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 147
1008660819_1008660823 -6 Left 1008660819 6:53665776-53665798 CCACTGGATAAGGCAGGCCGAGC 0: 1
1: 0
2: 1
3: 9
4: 95
Right 1008660823 6:53665793-53665815 CCGAGCCTGCGCTTTGGCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 147
1008660813_1008660823 6 Left 1008660813 6:53665764-53665786 CCCTTTGCCGTCCCACTGGATAA 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1008660823 6:53665793-53665815 CCGAGCCTGCGCTTTGGCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008660823 Original CRISPR CCGAGCCTGCGCTTTGGCCC GGG Intergenic
902560138 1:17272216-17272238 CCGAGCATGCGCAAAGGCCCGGG + Intronic
910392089 1:86756040-86756062 TAGAGCCTGGGCTTTGACCCAGG + Intergenic
910887896 1:91985662-91985684 CGGAGTCTGCTCTTTTGCCCAGG + Intronic
913450321 1:118988453-118988475 CTGGCGCTGCGCTTTGGCCCGGG - Intronic
913957619 1:143319272-143319294 CCTGGCCTGAGCATTGGCCCTGG - Intergenic
914051930 1:144144636-144144658 CCTGGCCTGAGCATTGGCCCTGG - Intergenic
914127267 1:144821905-144821927 CCTGGCCTGAGCATTGGCCCTGG + Intergenic
914256245 1:145962596-145962618 CCGAGCCGGCGCTGTGCCCGGGG - Exonic
915601023 1:156923548-156923570 TCGGGCCTGCGCTTTCTCCCAGG + Intronic
917456232 1:175188358-175188380 CCTGGCCTGGGCTCTGGCCCTGG + Intronic
918444702 1:184605654-184605676 CCAATCCTTGGCTTTGGCCCAGG - Intronic
920340525 1:205272634-205272656 CTGAGCCTGCTCTCTGGCCCTGG - Exonic
922818158 1:228465840-228465862 CAGAGCCTGCTCTATGCCCCGGG + Intergenic
924052394 1:240092177-240092199 CCGAGGATGCGCTGGGGCCCAGG + Exonic
1063434308 10:6018181-6018203 CTCAGCCTGCCCTGTGGCCCTGG - Intronic
1066961566 10:42231457-42231479 CCTGGCCTGAGCATTGGCCCTGG - Intergenic
1067087395 10:43250176-43250198 CCGAGACTGCGCATTGGCCAAGG - Intronic
1077159787 11:1107488-1107510 CCGACCCTGTGCAGTGGCCCCGG + Intergenic
1083234294 11:61341938-61341960 CCCTGCCTGCTCCTTGGCCCTGG + Intronic
1084326939 11:68405946-68405968 CCGGGCCTGCGATCTGGCCCAGG - Intronic
1084480329 11:69416152-69416174 CCGAGCCTGTGGTTGGGCCACGG - Intergenic
1085460525 11:76690377-76690399 GCAAGCCTGAGCTCTGGCCCAGG + Intergenic
1090797824 11:130150448-130150470 CCCAGCCTGCTCCCTGGCCCAGG - Intergenic
1090936900 11:131351226-131351248 CAGAGCCAGCTCTTTTGCCCTGG + Intergenic
1097232869 12:57522903-57522925 CCGAGCCTCCGGTACGGCCCCGG - Exonic
1099729731 12:86484819-86484841 CCAAGCCTGCTCTTGGGCCTTGG - Intronic
1099945440 12:89238708-89238730 CTGGGCCTGCGCTTTGGCAGGGG + Intergenic
1101996727 12:109530846-109530868 CCGAGCCTGCTGTGTGTCCCTGG + Intronic
1104274409 12:127311884-127311906 CCGAGCCTGCACTTTTTTCCAGG - Intergenic
1104976272 12:132553310-132553332 CTGAGCCTGCACTTTGACCTGGG + Intronic
1105927171 13:25018592-25018614 CCGGGCATGGGCTTCGGCCCAGG - Intergenic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1111051822 13:82892671-82892693 CCGAGCTTTCTCTTTCGCCCAGG - Intergenic
1112415353 13:99200143-99200165 GCGACCCTGCGCTTCTGCCCTGG - Intergenic
1112494682 13:99895610-99895632 GCGAGCCCGCGCTTGGGACCCGG + Exonic
1121272506 14:92647787-92647809 CCCAGCCTGTGATGTGGCCCAGG + Intronic
1122088729 14:99323941-99323963 GCCAGTCTCCGCTTTGGCCCTGG - Intergenic
1125709624 15:41774445-41774467 CCCAGCCCGCGGCTTGGCCCAGG + Intronic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1128390360 15:67178594-67178616 CAGAGCCTGCGCTTGGGCAGTGG + Intronic
1128943611 15:71807512-71807534 CCAAGCCTGCCCTTAAGCCCGGG + Intronic
1129606540 15:77027974-77027996 GCGATCCTGGGCTGTGGCCCCGG + Intronic
1132370690 15:101295613-101295635 CCGGGCCTGGGCCTTGGCTCCGG + Intergenic
1132667786 16:1089965-1089987 CTCAGGCTGCACTTTGGCCCAGG - Intergenic
1135002634 16:18789986-18790008 CTGAGGCAGCGCCTTGGCCCCGG - Intronic
1137601553 16:49759854-49759876 CTGCACCTGCCCTTTGGCCCTGG + Intronic
1139265667 16:65636154-65636176 GCGAGCCTGGGCTCTGACCCAGG + Intergenic
1143889173 17:10089133-10089155 CAGAGTCTGCTCTGTGGCCCAGG - Intronic
1143931649 17:10435296-10435318 CCGAGCCAGGGCTTTGGAGCTGG + Intergenic
1146039763 17:29440599-29440621 CAGAGTCTGCTCTTTTGCCCAGG + Intronic
1146604903 17:34249824-34249846 CAGAGCCAGGCCTTTGGCCCTGG + Intergenic
1147132606 17:38418205-38418227 GCCAGCCTGGGCATTGGCCCAGG + Intergenic
1147266903 17:39239926-39239948 TCGAGCCTGAGCTCTGGCTCAGG + Intergenic
1147923044 17:43930322-43930344 CCTAGGCTGCACTTGGGCCCAGG - Intergenic
1151994427 17:77599722-77599744 CCAAGCCTGACTTTTGGCCCTGG + Intergenic
1152037343 17:77881370-77881392 CAGAGCTTGTGCCTTGGCCCTGG - Intergenic
1152633973 17:81423000-81423022 CCGGGCCTGTGGTCTGGCCCCGG + Intronic
1153955164 18:10089915-10089937 CTGAGCCTGCCGTGTGGCCCTGG + Intergenic
1154415575 18:14173794-14173816 CCCAGCCTGGGCCCTGGCCCTGG - Intergenic
1155499540 18:26472996-26473018 CAGAGACTGCACTTTGGCCTTGG + Intronic
1158554726 18:58465802-58465824 CCCTGCCTTCGCTTTGCCCCAGG - Intergenic
1162756849 19:12865883-12865905 CCCAGCCTGTGCTGTGGCCCCGG + Intronic
1163014127 19:14443376-14443398 CCCAGCCTGGGCATTGCCCCTGG - Intronic
1163155794 19:15439339-15439361 CCCAGCCTGGCCTTTGGCCCAGG - Intronic
1163489001 19:17606048-17606070 CCGCGCCTGCGCCTTAGCGCGGG - Exonic
1165950036 19:39469194-39469216 CCGCCCCTGCTCCTTGGCCCAGG - Intronic
1167246444 19:48375934-48375956 CAGGGCCTGTGCTTTGGCCTAGG + Intronic
1167469176 19:49665959-49665981 CCGCGCCTGCGCACTGGGCCGGG - Exonic
1167723318 19:51193804-51193826 CAGAGCTTGCTCTTTCGCCCAGG - Intergenic
1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG + Intronic
1202691328 1_KI270712v1_random:97060-97082 CCTGGCCTGAGCATTGGCCCTGG - Intergenic
927971351 2:27307768-27307790 CCGAGTCTGCGCTGGAGCCCCGG - Exonic
928414262 2:31078687-31078709 CTGAGCATGCGGTGTGGCCCCGG - Intronic
929654742 2:43719463-43719485 CGGAGCCTGCTCTGTCGCCCAGG + Intronic
931463573 2:62468231-62468253 AAGAGGCTGCGGTTTGGCCCAGG + Intergenic
931544853 2:63371730-63371752 CCTAGCCTTAGCCTTGGCCCTGG - Intronic
932406185 2:71513777-71513799 CCGGGCCTCCGCTTTGATCCAGG - Exonic
934461695 2:94216458-94216480 CCTGGCCTGAGCATTGGCCCTGG + Intergenic
934619358 2:95794539-95794561 AATAGCCTGAGCTTTGGCCCTGG + Intergenic
934641534 2:96030018-96030040 AATAGCCTGAGCTTTGGCCCTGG - Intronic
1172360793 20:34311553-34311575 ACAAGCCTGCCCTTTGGCCGCGG + Intronic
1172763156 20:37336233-37336255 CCGTCCCTGCCCTTTGGACCTGG - Intergenic
1175401390 20:58701581-58701603 CCGGGGCTGCTCTTGGGCCCTGG - Intronic
1175719606 20:61277987-61278009 CAGAGCCTGCGTTATGGCCCAGG + Intronic
1175967500 20:62666772-62666794 CAGTGCCTGCGCTTGGGTCCCGG + Intronic
1176865854 21:14054837-14054859 CCTGGCCTGAGCATTGGCCCTGG - Intergenic
1179273123 21:39866730-39866752 AGGAGCCTGGGCATTGGCCCTGG - Intergenic
1180550116 22:16531523-16531545 CCTGGCCTGAGCATTGGCCCTGG + Intergenic
1180945396 22:19689603-19689625 CCGACCCTGAGCTGGGGCCCTGG + Intergenic
1180962235 22:19767129-19767151 CCGACCGGGCGCTTTGGCACTGG - Exonic
1181206312 22:21255626-21255648 CCGAGCCTGCACCATGACCCCGG - Intergenic
1181354558 22:22290298-22290320 CCTGGCCTGAGCATTGGCCCTGG - Intergenic
1183306113 22:37084097-37084119 CCCAGCCTCCGCCCTGGCCCCGG - Intronic
1183487499 22:38097416-38097438 CTGAGCCTTCGCTCTGTCCCTGG + Intronic
1184756216 22:46517328-46517350 CCAAGTCTCCGGTTTGGCCCGGG - Intronic
1203220608 22_KI270731v1_random:39797-39819 CCGAGCCTGCACCATGACCCCGG + Intergenic
1203270216 22_KI270734v1_random:47025-47047 CCGAGCCTGCACCATGACCCCGG - Intergenic
951621771 3:24609591-24609613 GTGAGCCTGAGCTTTGTCCCAGG + Intergenic
954266033 3:49470717-49470739 TGGAGCCTGCGCCTTGGCCGCGG + Intronic
955763812 3:62318983-62319005 CCTGGCCTGCGCTAAGGCCCCGG + Intronic
957048807 3:75396257-75396279 CCGGGCATGGGCTTCGGCCCGGG - Intergenic
960602156 3:119469124-119469146 CCGAGCCTGCCCCTTGGGCTCGG + Intronic
962267751 3:133955578-133955600 ACGGGCCTGGGCTTTGACCCTGG - Intronic
962383116 3:134912701-134912723 CAGAGGCTGCCCTCTGGCCCAGG - Intronic
962545393 3:136429109-136429131 CCCAGCCTGCGCTCTGTTCCAGG - Intronic
963537279 3:146544390-146544412 CGGAGCCTGCGCTGGGGCCAGGG - Intronic
968372873 4:11579-11601 CCGCGCCTGCGCCTTGTCCTCGG - Intergenic
968552300 4:1229887-1229909 CCCAGCCTCTGCTGTGGCCCTGG - Intronic
968556384 4:1248307-1248329 CGGGGGCTGCGCTTTGGGCCCGG + Intronic
968770363 4:2501757-2501779 CTGAGTCTTCGCCTTGGCCCTGG + Intronic
972739187 4:41874494-41874516 CAGACCCTGGCCTTTGGCCCAGG + Intergenic
973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG + Exonic
979765711 4:124462609-124462631 CCGAGATTGCACTTTGGCCTGGG - Intergenic
983224780 4:165075593-165075615 TGGAGCCTGCTCTGTGGCCCAGG + Exonic
985462523 4:190120988-190121010 CCGCGCCTGCGCCTTGTCCTCGG + Intergenic
987286915 5:16466065-16466087 CCGAGGCTGCTCCTGGGCCCTGG + Intergenic
987405380 5:17518966-17518988 CAGACCCTGCCCTCTGGCCCTGG - Intergenic
987407425 5:17585137-17585159 CAGACCCTGCCCTCTGGCCCTGG + Intergenic
987408571 5:17593773-17593795 CAGACCCTGCCCTCTGGCCCTGG + Intergenic
987409027 5:17597207-17597229 CAGACCCTGCCCTCTGGCCCTGG + Intergenic
988264139 5:28928146-28928168 CCGGGCATGGGCTTTGGCCCGGG - Intergenic
990008265 5:50967074-50967096 CCGAGGATGCGCTTTGGACTTGG + Intergenic
990539399 5:56757226-56757248 CCCAGGCTGTGGTTTGGCCCCGG + Intergenic
1002465765 5:179407691-179407713 CTGAGCCTGTGCCTCGGCCCTGG + Intergenic
1004195042 6:13496081-13496103 CCCAGGCTGCACTTTGGCCCTGG - Intergenic
1008629466 6:53349212-53349234 CAGAGCCTGCGCAATAGCCCCGG + Intergenic
1008660823 6:53665793-53665815 CCGAGCCTGCGCTTTGGCCCGGG + Intergenic
1022526707 7:31042754-31042776 CCCAGCCAGAGCTTCGGCCCAGG - Intergenic
1029877413 7:103769118-103769140 CTGAACCTGTGCTTTGGGCCAGG + Intronic
1033155588 7:138954490-138954512 GAGAGCCTGCGCTTTGGCAGGGG - Intronic
1033546379 7:142405166-142405188 CCCCGCCTGCGGTTTGGCCGTGG - Intergenic
1036082573 8:5573497-5573519 CCGAGGCTGGGCTTTGGCTGTGG - Intergenic
1040545255 8:48393950-48393972 CAAAGCCTGTGCTTTGGCCACGG - Intergenic
1048318351 8:133378463-133378485 CCGAGCTTCCCCTTTTGCCCTGG + Intergenic
1048852076 8:138654943-138654965 CTGAACCTGCGCTCTGGTCCTGG + Intronic
1049252961 8:141598946-141598968 CCGACCCTGCCCTCTGGCTCTGG + Intergenic
1049714449 8:144083253-144083275 CCGTGCCCGGGCTTTTGCCCGGG + Exonic
1051977070 9:22963503-22963525 CCATGCCTGCACTTTGACCCTGG + Intergenic
1053431938 9:38047858-38047880 CCGAGCTAACGCTGTGGCCCCGG + Intronic
1053692168 9:40592110-40592132 CCTGGCCTGAGCATTGGCCCTGG + Intergenic
1054272632 9:63045375-63045397 CCTGGCCTGAGCATTGGCCCTGG - Intergenic
1054303426 9:63393076-63393098 CCTGGCCTGAGCATTGGCCCTGG + Intergenic
1054402205 9:64719586-64719608 CCTGGCCTGAGCATTGGCCCTGG + Intergenic
1054435810 9:65203901-65203923 CCTGGCCTGAGCATTGGCCCTGG + Intergenic
1054494582 9:65817786-65817808 CCTGGCCTGAGCATTGGCCCTGG - Intergenic
1060554798 9:124502791-124502813 CCGACCCTGTGCTGGGGCCCTGG + Intronic
1060806521 9:126581052-126581074 CCCAGCCTGCTCTTGGGGCCTGG - Intergenic
1061215926 9:129222074-129222096 CCGGGCCTGGGTTGTGGCCCAGG + Intergenic
1061414476 9:130438885-130438907 CCAAGCCTGGGCATTGGCCCTGG - Intergenic
1061553148 9:131349608-131349630 TCGAGCCTGGGCTTGGGCTCAGG - Intergenic
1062053368 9:134458451-134458473 CGGAGCCTGCGGTGGGGCCCTGG + Intergenic
1187479045 X:19638382-19638404 CGGAGTCTGCTCTTTCGCCCAGG - Intronic
1189213762 X:39305982-39306004 CTGAGCTTGTTCTTTGGCCCTGG - Intergenic
1192262260 X:69512432-69512454 TCGAGCAGGAGCTTTGGCCCTGG - Intronic
1194059863 X:89182971-89182993 CCGAGACTGCCCTGAGGCCCAGG + Intergenic
1195202239 X:102563255-102563277 CAGAGGCTCCGCTTTGACCCAGG + Intergenic
1198223150 X:134621418-134621440 CAGAGCCTGCTCTGTTGCCCGGG - Intronic