ID: 1008661951

View in Genome Browser
Species Human (GRCh38)
Location 6:53677809-53677831
Sequence CTGTCCACATTGGCCAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008661944_1008661951 16 Left 1008661944 6:53677770-53677792 CCGGACCTCCTGAGAAGCTTTCT No data
Right 1008661951 6:53677809-53677831 CTGTCCACATTGGCCAAGGATGG No data
1008661942_1008661951 23 Left 1008661942 6:53677763-53677785 CCAACCGCCGGACCTCCTGAGAA No data
Right 1008661951 6:53677809-53677831 CTGTCCACATTGGCCAAGGATGG No data
1008661945_1008661951 11 Left 1008661945 6:53677775-53677797 CCTCCTGAGAAGCTTTCTAAAGT No data
Right 1008661951 6:53677809-53677831 CTGTCCACATTGGCCAAGGATGG No data
1008661943_1008661951 19 Left 1008661943 6:53677767-53677789 CCGCCGGACCTCCTGAGAAGCTT No data
Right 1008661951 6:53677809-53677831 CTGTCCACATTGGCCAAGGATGG No data
1008661941_1008661951 30 Left 1008661941 6:53677756-53677778 CCATGCTCCAACCGCCGGACCTC No data
Right 1008661951 6:53677809-53677831 CTGTCCACATTGGCCAAGGATGG No data
1008661947_1008661951 8 Left 1008661947 6:53677778-53677800 CCTGAGAAGCTTTCTAAAGTGGG No data
Right 1008661951 6:53677809-53677831 CTGTCCACATTGGCCAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008661951 Original CRISPR CTGTCCACATTGGCCAAGGA TGG Intergenic