ID: 1008662437

View in Genome Browser
Species Human (GRCh38)
Location 6:53681963-53681985
Sequence AGCCCTGGGCCCAGTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008662428_1008662437 0 Left 1008662428 6:53681940-53681962 CCATGTGCCCTTTGCATAACCCC No data
Right 1008662437 6:53681963-53681985 AGCCCTGGGCCCAGTCCTGGAGG No data
1008662429_1008662437 -7 Left 1008662429 6:53681947-53681969 CCCTTTGCATAACCCCAGCCCTG No data
Right 1008662437 6:53681963-53681985 AGCCCTGGGCCCAGTCCTGGAGG No data
1008662430_1008662437 -8 Left 1008662430 6:53681948-53681970 CCTTTGCATAACCCCAGCCCTGG No data
Right 1008662437 6:53681963-53681985 AGCCCTGGGCCCAGTCCTGGAGG No data
1008662426_1008662437 20 Left 1008662426 6:53681920-53681942 CCAGATCACAGAGGTTCCGTCCA No data
Right 1008662437 6:53681963-53681985 AGCCCTGGGCCCAGTCCTGGAGG No data
1008662427_1008662437 4 Left 1008662427 6:53681936-53681958 CCGTCCATGTGCCCTTTGCATAA No data
Right 1008662437 6:53681963-53681985 AGCCCTGGGCCCAGTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008662437 Original CRISPR AGCCCTGGGCCCAGTCCTGG AGG Intergenic
No off target data available for this crispr