ID: 1008673084

View in Genome Browser
Species Human (GRCh38)
Location 6:53793764-53793786
Sequence TTTTAGCTATAGCAGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008673080_1008673084 -10 Left 1008673080 6:53793751-53793773 CCGTGGCTCCAGATTTTAGCTAT No data
Right 1008673084 6:53793764-53793786 TTTTAGCTATAGCAGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008673084 Original CRISPR TTTTAGCTATAGCAGCTGGA GGG Intergenic
No off target data available for this crispr