ID: 1008673313

View in Genome Browser
Species Human (GRCh38)
Location 6:53794978-53795000
Sequence TAGGAAGCTCCGCGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008673310_1008673313 -5 Left 1008673310 6:53794960-53794982 CCGCGCGGCGGCTGCGAGTAGGA 0: 1
1: 0
2: 0
3: 4
4: 36
Right 1008673313 6:53794978-53795000 TAGGAAGCTCCGCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 74
1008673304_1008673313 29 Left 1008673304 6:53794926-53794948 CCTCGGCGCGCACCCACTGGCGC 0: 1
1: 0
2: 1
3: 11
4: 129
Right 1008673313 6:53794978-53795000 TAGGAAGCTCCGCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 74
1008673305_1008673313 17 Left 1008673305 6:53794938-53794960 CCCACTGGCGCGCATGCTCAGTC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1008673313 6:53794978-53795000 TAGGAAGCTCCGCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 74
1008673303_1008673313 30 Left 1008673303 6:53794925-53794947 CCCTCGGCGCGCACCCACTGGCG 0: 1
1: 0
2: 1
3: 5
4: 42
Right 1008673313 6:53794978-53795000 TAGGAAGCTCCGCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 74
1008673306_1008673313 16 Left 1008673306 6:53794939-53794961 CCACTGGCGCGCATGCTCAGTCC 0: 1
1: 0
2: 0
3: 12
4: 285
Right 1008673313 6:53794978-53795000 TAGGAAGCTCCGCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008673313 Original CRISPR TAGGAAGCTCCGCGCGGCGG CGG Exonic