ID: 1008677496

View in Genome Browser
Species Human (GRCh38)
Location 6:53835795-53835817
Sequence CAGTTTTCATGTGTGTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 339}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008677493_1008677496 3 Left 1008677493 6:53835769-53835791 CCATAGAATTTTGTACATAATCT 0: 1
1: 0
2: 3
3: 47
4: 375
Right 1008677496 6:53835795-53835817 CAGTTTTCATGTGTGTTCTGTGG 0: 1
1: 0
2: 1
3: 19
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008677496 Original CRISPR CAGTTTTCATGTGTGTTCTG TGG Intronic
901038695 1:6351341-6351363 GAGGTTTCTTGTGTGCTCTGGGG - Intronic
902309655 1:15572184-15572206 CAGTTTTGTTTTGTTTTCTGGGG + Intronic
903277670 1:22232174-22232196 CAGTTTTCTTGAGTGTACAGTGG - Intergenic
903883651 1:26529411-26529433 CAGTGTGAATGTGTGTGCTGGGG + Intergenic
906479205 1:46189264-46189286 GAGGTCTCATGTCTGTTCTGGGG + Exonic
906717012 1:47977887-47977909 CTGATTTCATGTGTGATCTTGGG + Intronic
907939784 1:59076535-59076557 TAGTTTTCAAGGGTGTTGTGAGG - Intergenic
907986959 1:59541532-59541554 CTGTTTTCTTGTGAGTTCTTTGG - Intronic
908659550 1:66422159-66422181 AAGTTTGGATGGGTGTTCTGCGG + Intergenic
909331009 1:74410895-74410917 CAGTGTTCACTTGTGTCCTGTGG + Intronic
910775477 1:90870626-90870648 GAGTTTTCTTGTGTGTTGTGAGG - Intergenic
911810197 1:102266562-102266584 CAGTTCTTATGTGTGTTTTCAGG + Intergenic
912564671 1:110579147-110579169 GAGGGTTCATGAGTGTTCTGAGG + Intergenic
913529543 1:119723970-119723992 CAGGGTCCTTGTGTGTTCTGTGG + Intronic
916084795 1:161260569-161260591 CAGTTAGCCTGTGTTTTCTGGGG + Intronic
916436304 1:164780998-164781020 CTGTTTGCCTGTGTGTTCCGTGG + Intronic
916904325 1:169265247-169265269 CAGTTTTCTTGAGTTTGCTGAGG - Intronic
917945296 1:179963536-179963558 CAGTTTTTTTGTGTGTTTTTTGG + Intronic
917997549 1:180456531-180456553 CACTTTTCATGTGCTTTCTTAGG - Intronic
918323401 1:183386019-183386041 CAGTTTTTATGTCTCTTCTCTGG - Intronic
918707849 1:187690368-187690390 CATTTTTAAAGTGTGTTCTTTGG + Intergenic
918736571 1:188071544-188071566 GAATTTTCAGGTGTGTTCAGCGG + Intergenic
918754524 1:188321348-188321370 CAGTTTTCCTGTGTTTTCTAGGG - Intergenic
919558933 1:199094530-199094552 AAGTTGGGATGTGTGTTCTGTGG - Intergenic
919882321 1:201908776-201908798 CAGTTTCCATGTGGGTTATTTGG - Intronic
919981451 1:202644713-202644735 CAGTGTGCATGTGTGTTGGGGGG + Intronic
919989379 1:202698507-202698529 CAGTCTTCATGTCCCTTCTGTGG - Intronic
921093019 1:211860796-211860818 CATTATTCGTGTGTATTCTGTGG + Intergenic
921664774 1:217855635-217855657 CAGTTTGCATGTCTGTCATGTGG + Intronic
922217153 1:223529280-223529302 GAGTTTCCATCTGTCTTCTGGGG - Intergenic
923125563 1:231031618-231031640 CAGTTTCAAAGTGTGGTCTGGGG - Intronic
923256069 1:232222682-232222704 CAGTTTTCAAGGTTGCTCTGTGG - Intergenic
924027379 1:239848867-239848889 CTGTATTCATGTATGTGCTGTGG - Intronic
924135394 1:240960609-240960631 CAGGCTTCATTTGTTTTCTGAGG - Intronic
1062944290 10:1448958-1448980 CAGGCTGCATGTGTGTCCTGTGG - Intronic
1063266222 10:4454054-4454076 GATTTTTCATGAGTTTTCTGGGG + Intergenic
1063709507 10:8463655-8463677 CAGTTTCCATGGGGTTTCTGCGG - Intergenic
1063805489 10:9634850-9634872 TAATTTTCATGTGTTATCTGAGG + Intergenic
1064578576 10:16770455-16770477 CAGATTTCATGCCTGTGCTGCGG - Intronic
1065131255 10:22622453-22622475 CAGTTACCATCTGTGCTCTGAGG + Intronic
1068328217 10:55524020-55524042 CAGTTTTCAGCAGTGTTTTGGGG - Intronic
1068399570 10:56510145-56510167 CAATTTTCATGTGTGGTGGGAGG + Intergenic
1068802020 10:61152194-61152216 GAGTGTTCAGGTGTGTTTTGGGG + Intergenic
1069808870 10:71143910-71143932 TAGTATTCCTGTGAGTTCTGCGG - Intergenic
1070941546 10:80352922-80352944 CATTTTTCAGGTATGTTGTGAGG - Intronic
1070941664 10:80353761-80353783 CATTTTTCAGGTATGTTGTGAGG + Intronic
1071376239 10:85007483-85007505 CAGTGTTCATCTGAGTTATGTGG + Intergenic
1071382241 10:85078702-85078724 TAGTTTTCATGTGAATTTTGTGG + Intergenic
1073250199 10:102116587-102116609 CAGTTTTGGTGTGTGTATTGAGG - Intronic
1074955978 10:118390113-118390135 TAGTTTTCATGTGAATTCTTTGG + Intergenic
1075657425 10:124171439-124171461 CAGGTGTCATGAGGGTTCTGAGG - Intergenic
1075964148 10:126595934-126595956 TAATTTTCATGTGTGGTGTGAGG - Intronic
1076222405 10:128745171-128745193 CAGATTTCAAGTGCTTTCTGCGG - Intergenic
1076245522 10:128944811-128944833 CAGTTCTGCTGTGTGTTCTGTGG - Intergenic
1077864906 11:6214269-6214291 GAGTCTTCATGTTTGTTCTCAGG - Intronic
1077900422 11:6482936-6482958 CAGGTTTCATCTCTCTTCTGTGG - Exonic
1079464281 11:20713947-20713969 CAGTTTGCATGTATGTTTGGAGG + Intronic
1081349569 11:42033885-42033907 CTGTTTTCATGTGTGTCAAGTGG + Intergenic
1084074447 11:66762242-66762264 CAGTTTGCGCGCGTGTTCTGCGG - Intronic
1086304145 11:85461599-85461621 CAGTTTTAATGTGTTTACTTAGG + Intronic
1086938323 11:92768100-92768122 CAGTTTTCATGTTTCTTCATTGG + Intronic
1087543677 11:99554770-99554792 CAGTTATTATGTGTGATATGTGG + Intronic
1088387596 11:109276286-109276308 CAGTTAGGATGTGTGTTCTCGGG + Intergenic
1088449845 11:109969250-109969272 CAGATTTAATGTTTGTTATGCGG + Intergenic
1088551167 11:111013814-111013836 CAGTTTTCATGTTTCATCTCTGG + Intergenic
1089097180 11:115928858-115928880 CAGTTTTCTTGTCTGTTCAATGG - Intergenic
1090255631 11:125281873-125281895 AAGGTTTCATGTGAGTTCAGAGG - Intronic
1091113116 11:132989377-132989399 CATTTTTTATGTGTGATTTGGGG - Intronic
1091444840 12:538680-538702 CAGTCTTCATGGATGTTCAGGGG + Intronic
1091479879 12:816668-816690 CAATTATCATGTATGTTCTTCGG - Intronic
1093110235 12:15143232-15143254 CAGTTTTTGTCTTTGTTCTGAGG - Intronic
1093215761 12:16359647-16359669 AAGTTTTCATGTCTCTTCAGTGG - Intronic
1093457891 12:19382503-19382525 CACTTTTACTGTGTGTTCTCAGG + Intergenic
1095136148 12:38606497-38606519 CAGTTTTCTTGTGTAATCTTTGG - Intergenic
1096363981 12:51012673-51012695 TAGGTTTCATCTGTCTTCTGGGG + Intronic
1099633750 12:85185623-85185645 AAATTTTCAAGTGTGATCTGAGG + Intronic
1101874070 12:108587562-108587584 CCGTTTTCATGTGTGTAAAGAGG - Intergenic
1102131257 12:110530522-110530544 CAGTTTTCTTGCATGTTCTTTGG + Exonic
1103204809 12:119120355-119120377 CAGTTTCCATCTGTGCTCTTAGG + Intronic
1103466633 12:121147006-121147028 CAGTTTTCTTGTGAATTCTTTGG - Intronic
1103633267 12:122280604-122280626 CAGTTTTGATGAGTGTGCCGGGG + Intronic
1104886907 12:132115781-132115803 CACTTCTCAAGTGTGTTCTGGGG + Intronic
1105762731 13:23528832-23528854 AAGTTGTGATGTGTGGTCTGTGG - Intergenic
1106141701 13:27017303-27017325 CAGTTTTCAAGCTTTTTCTGGGG + Intergenic
1106623930 13:31399398-31399420 CAGTTCTCATGTGTTTTTGGTGG + Intergenic
1107731252 13:43351276-43351298 GAGATTGCATGTGTGTTTTGGGG - Intronic
1107826905 13:44336979-44337001 CAGTCTTCCTTTCTGTTCTGGGG - Intergenic
1108231355 13:48345754-48345776 CTGTTATCATGTTTGTTTTGAGG + Intronic
1108382523 13:49868047-49868069 CAATTTCCATGTGTGTCCGGAGG - Intergenic
1108630696 13:52279114-52279136 CAGTCTTCATGTGACTTCTTTGG + Intergenic
1108655990 13:52533426-52533448 CAGTCTTCATGTGACTTCTTTGG - Intergenic
1109570901 13:64188255-64188277 CAGATTTGAGGTGTGTTTTGAGG - Intergenic
1111236526 13:85416598-85416620 AATTTTTAATGTGTGTTATGTGG - Intergenic
1113278673 13:108764132-108764154 CTGTCTTCATGTTTGTGCTGAGG - Intronic
1113292628 13:108923263-108923285 CTGTTTTCAACCGTGTTCTGAGG - Intronic
1113370558 13:109721268-109721290 CTTTTTTTATGTGTGTTTTGTGG - Intergenic
1115108684 14:29793502-29793524 TCTTTTCCATGTGTGTTCTGTGG + Intronic
1116523256 14:45874309-45874331 CAGTTTTCAAGATTATTCTGGGG - Intergenic
1116824117 14:49655292-49655314 CAGATTTTATGGATGTTCTGAGG - Intronic
1118066175 14:62193159-62193181 CACTGTTGATGTGTGTTCTAAGG + Intergenic
1119176110 14:72568646-72568668 CATTTTCCATGTGGGGTCTGGGG - Intergenic
1119632693 14:76247546-76247568 CAGTTTCTATGTATGTTGTGTGG + Intronic
1119667152 14:76493099-76493121 CAGTGTCCTTGTGTGTTCAGTGG + Intronic
1120230789 14:81838501-81838523 CAATATTCATATGTGGTCTGTGG - Intergenic
1120380909 14:83778431-83778453 CAGTTTTCATGACACTTCTGGGG - Intergenic
1120523685 14:85553238-85553260 CAGTCTTTATCTGTGTTTTGTGG - Intronic
1121507188 14:94486160-94486182 CAGTTTCCATGTCTGTTATAGGG + Intergenic
1121535476 14:94687645-94687667 CAGGTTCAATGTGTGTTTTGGGG - Intergenic
1121721397 14:96111345-96111367 CAGTTCTCATCTGTATACTGAGG - Intergenic
1121728541 14:96170489-96170511 CATTAGCCATGTGTGTTCTGAGG + Intergenic
1123403746 15:20008790-20008812 CTGTTTCCATGAGTTTTCTGGGG + Intergenic
1123467437 15:20527299-20527321 CAGTTTCCCTATCTGTTCTGTGG + Intergenic
1123513085 15:21015436-21015458 CTGTTTCCATGAGTTTTCTGGGG + Intergenic
1123650677 15:22473743-22473765 CAGTTTCCCTATCTGTTCTGTGG - Intergenic
1123830916 15:24136376-24136398 CCGCTTTCCTGTGTCTTCTGGGG - Intergenic
1123835994 15:24193751-24193773 CGGCTTTCCTGTGTCTTCTGGGG - Intergenic
1124278184 15:28343290-28343312 CAGTTTCCCTATCTGTTCTGTGG + Intergenic
1124304517 15:28568318-28568340 CAGTTTCCCTATCTGTTCTGTGG - Intergenic
1125132073 15:36294473-36294495 CAGTTTACACTTGTGTTATGGGG + Intergenic
1125907700 15:43408563-43408585 TAATTTCCATGTTTGTTCTGGGG + Intronic
1127391207 15:58506400-58506422 CAGTGGTCATGTGCCTTCTGTGG - Intronic
1129407485 15:75328904-75328926 CAGTGTTCAGCTGTGTCCTGGGG - Intergenic
1129470656 15:75751694-75751716 CAGTGTTCAGCTGTGTCCTGGGG - Intergenic
1129579119 15:76786754-76786776 GAGTTTTTATGTGTATTCTCTGG - Intronic
1129734332 15:77951441-77951463 CAGTGTTCAGCTGTGTCCTGGGG + Intergenic
1129841254 15:78744550-78744572 CAGTGTTCAGCTGTGTCCTGGGG - Intergenic
1130034508 15:80344795-80344817 ATCTTTTCATGTGTGTTCTAAGG + Intergenic
1130346463 15:83051389-83051411 CAATTATCATGTGTTTTATGGGG + Intronic
1130505599 15:84538004-84538026 CAGTTTTCTTTTATGTTCTATGG + Intergenic
1130766517 15:86876699-86876721 CAGTGTTCATGTATTGTCTGTGG - Intronic
1131428141 15:92364021-92364043 CACTTTTCATTTGTTTTCAGTGG + Intergenic
1131848203 15:96510494-96510516 CATTTATCATGTGTTTACTGTGG + Intergenic
1133083311 16:3341336-3341358 TAGTTTTTATGTGGGTTCTTTGG + Intergenic
1134163225 16:11909401-11909423 CAGTTTTCTTGATTGTTCTGAGG + Intronic
1134609467 16:15597069-15597091 CAGTTTACATATGAGTTGTGTGG + Intronic
1134777513 16:16866007-16866029 CAGTTGTTGTGTGTGTTTTGGGG + Intergenic
1134796483 16:17041807-17041829 CAGTTTCCATGTCTGTTAAGTGG + Intergenic
1135308250 16:21385307-21385329 CAGTTTCAAGGTGTGCTCTGTGG + Intergenic
1136013602 16:27381173-27381195 CTGTTTTCATTTGTGTGTTGTGG + Intergenic
1136025921 16:27469157-27469179 GTGTTTTTCTGTGTGTTCTGTGG + Intronic
1136304994 16:29364433-29364455 CAGTTTCAAGGTGTGCTCTGTGG + Intergenic
1136651420 16:31675860-31675882 TAGTTTTCTAGTGTTTTCTGAGG - Intergenic
1137301703 16:47155102-47155124 CAGTTTTCTTGTTTATTCAGTGG - Exonic
1137494793 16:48961431-48961453 CAGTTTTCAAGTTTTCTCTGGGG + Intergenic
1137834045 16:51573430-51573452 CAGTTTCCATTTGTGACCTGTGG + Intergenic
1137989976 16:53144422-53144444 AAGTTTTAATTTGTGTTTTGGGG + Intronic
1138038334 16:53631580-53631602 CAGTTTTGATGTCTGTTTTGAGG + Intronic
1138297327 16:55898102-55898124 CAGTTTTGATCTGTGTCATGTGG + Intronic
1138993607 16:62421588-62421610 CATTTTTCATGTGACTTCAGAGG - Intergenic
1139231852 16:65291037-65291059 CAGTTTTCATGTCTGCACTGGGG + Intergenic
1139280777 16:65768668-65768690 CAGTTTTCAAGGTTTTTCTGGGG - Intergenic
1139639596 16:68281512-68281534 CTCTGTTCATATGTGTTCTGGGG + Intronic
1141630011 16:85282457-85282479 GAGTTCTCATGTGTGTTTTGGGG + Intergenic
1141938741 16:87260152-87260174 CAGTTTTCAAGTTTGCTCTGGGG - Intronic
1141983423 16:87563912-87563934 GTGTGTTCATGTGTGTGCTGGGG + Intergenic
1142296525 16:89226765-89226787 GAGTTCTCACGTGTGTGCTGAGG - Exonic
1144116968 17:12104784-12104806 TTGTTTTTATGTGTGTTCTTGGG + Intronic
1150513773 17:65785314-65785336 CAGTTCTCCTGTGTGTACTTAGG + Intronic
1150520721 17:65865028-65865050 CTGTTTTTTTGTGTGTTTTGTGG + Intronic
1150593002 17:66579536-66579558 CAGTTTTCACATGTGTGCAGTGG - Intronic
1151155150 17:72118783-72118805 CAGTTTTCATCTGTATCCAGAGG - Intergenic
1151936515 17:77265263-77265285 CAGTTTTCTTATCTGCTCTGTGG - Intergenic
1152231023 17:79114292-79114314 CCTTTTCCATGTGTGTCCTGTGG + Intronic
1155406935 18:25499124-25499146 TAGTTTTCATATGTGATGTGAGG - Intergenic
1155524440 18:26702204-26702226 CAGTTCTCAAGTGTGCTTTGGGG + Intergenic
1155824779 18:30426783-30426805 TAGTTTTCATTTGTGTCTTGTGG - Intergenic
1157507405 18:48238487-48238509 CAGTTAGGATGTGTGTTCAGAGG - Intronic
1158898579 18:61939571-61939593 CCATTTTGGTGTGTGTTCTGTGG - Intergenic
1159996366 18:74969501-74969523 CAGTTTGCTTGTTTGATCTGAGG + Intronic
1161091894 19:2364681-2364703 CAGTTTTGCTCTTTGTTCTGTGG - Intergenic
1161377358 19:3946820-3946842 CACCTTTCATGTGTGGTCTTGGG - Intergenic
1162013476 19:7831286-7831308 AAGTTTTTCTGTGTGTGCTGGGG - Intronic
1163521792 19:17795874-17795896 CAGTTTCCCTGTGTGTTAAGGGG + Intronic
1164074263 19:21799658-21799680 CATGCTTCATGAGTGTTCTGAGG + Intergenic
1164766683 19:30777684-30777706 CAGACTGCATGTGTGTGCTGAGG + Intergenic
1165613908 19:37181946-37181968 CAGTCTTGATGTGCATTCTGTGG - Exonic
1166628502 19:44383651-44383673 CAGTTCTTGTGTGTGTTATGAGG + Exonic
1167849716 19:52192085-52192107 CAGTTTTAAAGTGTGGTCAGGGG + Intronic
926459015 2:13104396-13104418 CATTTATTCTGTGTGTTCTGGGG + Intergenic
927629762 2:24762956-24762978 CAGGTGTCATGTTAGTTCTGTGG - Intronic
929234466 2:39591570-39591592 TACTTGTCATTTGTGTTCTGGGG - Intergenic
929913382 2:46113244-46113266 CTCTTTGCATGTGTATTCTGTGG + Intronic
930349269 2:50228892-50228914 CAGTTTTCCAGTTTGTTTTGAGG + Intronic
931275075 2:60737353-60737375 CAGTTTTTTTGTTTGTTTTGCGG + Intergenic
931583762 2:63805453-63805475 CAGTTTCAATTTCTGTTCTGGGG - Intronic
931739025 2:65225523-65225545 CAATTTTTATGTGTGATGTGAGG + Intergenic
931816392 2:65906779-65906801 TACTTTTCATGTGTGATGTGAGG - Intergenic
933415272 2:81979340-81979362 ACGGTTTCATGTGTGTCCTGGGG + Intergenic
933729060 2:85443674-85443696 CATGGTTCATGGGTGTTCTGAGG - Intergenic
935418003 2:102838699-102838721 CAGTTCAGACGTGTGTTCTGGGG + Intronic
935752619 2:106250881-106250903 GAGTTTTCTTGTGGATTCTGTGG + Intergenic
935913036 2:107918429-107918451 GAGTTTTCTTGTGGATTCTGTGG + Intergenic
936242787 2:110802291-110802313 CAGCTTCCAGGTGTGTTCTGGGG + Intronic
936507752 2:113121499-113121521 CAGTTATCTTGTGTTTTCAGCGG - Intronic
936904242 2:117518327-117518349 CAGTTTTCCTGTGTGTTAAATGG - Intergenic
936973621 2:118198000-118198022 CCCTTTTCTTTTGTGTTCTGTGG + Intergenic
938545102 2:132321485-132321507 CAGTTCTTGTGTGTGTTATGAGG - Intergenic
938669470 2:133573346-133573368 CAGATTACATGTGTGTTGAGGGG - Intergenic
940342879 2:152599994-152600016 CACTTTTCTGGGGTGTTCTGTGG - Intronic
940845885 2:158641879-158641901 AATTCTTGATGTGTGTTCTGAGG + Intronic
940885901 2:158988985-158989007 CAGTTTTAATGAGTGATATGGGG + Intronic
943234392 2:185299830-185299852 GAGTTTGCAACTGTGTTCTGGGG + Intergenic
944199878 2:197095248-197095270 CAGTGTCCATGTTTGTACTGAGG + Intronic
944474611 2:200090885-200090907 CAGTTTTCATCTCTGTCATGGGG - Intergenic
947430039 2:230019960-230019982 CAGTATTTATGTGTTATCTGTGG + Intergenic
948306286 2:236949355-236949377 GAGTTTGCATGTGTTTTGTGAGG - Intergenic
1169026598 20:2376761-2376783 CAGTTTTCTTATGTGTAATGTGG - Intergenic
1169047961 20:2551324-2551346 GAGTTTTCATGTGTGTATTTTGG + Intronic
1169506613 20:6218458-6218480 CAGTATTCTTGTCTGTTCTAGGG - Intergenic
1171873962 20:30554268-30554290 CAGTTCTTGTGTGTGTTATGAGG - Intergenic
1172985974 20:38989744-38989766 GATTTTACATGTGTGTTCTTTGG + Intronic
1173054264 20:39596031-39596053 CAGGTTTCATTTGGGTTTTGGGG - Intergenic
1173969379 20:47139853-47139875 AAGTTTGCATGTGTGTGTTGGGG - Intronic
1178582532 21:33848579-33848601 CAGTTTCCCTGTCTGTTCAGTGG + Intronic
1180232837 21:46437630-46437652 AATTCTTGATGTGTGTTCTGTGG + Intronic
1181451022 22:23021073-23021095 CACTTTTTGTGTGTGTTCTGGGG - Intergenic
1183313755 22:37126171-37126193 CACCTTTGCTGTGTGTTCTGGGG - Exonic
1184134141 22:42536443-42536465 CAGCTTGTATGTGTTTTCTGGGG - Intergenic
949396398 3:3618787-3618809 CATTTTTCATGTGGTTTCTGTGG + Intergenic
949716266 3:6935073-6935095 GTGTTTTCATGTTTGTTCTAGGG - Intronic
950327536 3:12125859-12125881 CAGTTTTTTTGTGTGTTTTGTGG - Intronic
950851316 3:16064569-16064591 CTGCTTTCATGTGTGCTCTTGGG + Intergenic
954052901 3:47996180-47996202 CGGTCTTCTTGTGTGCTCTGGGG - Intronic
954874770 3:53794877-53794899 CAGTTCTCAGGTGTGTTCTGGGG - Intronic
955305334 3:57825131-57825153 TAGTTTTCATGTGAATTCTATGG + Intronic
955874313 3:63474136-63474158 CAATTTTGAGGTGTGTTCAGAGG - Intronic
958118949 3:89259839-89259861 CAGTTTTCATGGGTGGAATGGGG - Intronic
959893387 3:111581401-111581423 AGGTTTTCATGGGTGTTTTGGGG - Intronic
961559219 3:127717326-127717348 CTGATTTCAGGTGTGTTTTGGGG + Intronic
963779999 3:149477594-149477616 CAGTTTCCATGTGAGTTCAAAGG + Intronic
963846429 3:150163081-150163103 CAGTTTTGCTCTGTTTTCTGGGG + Intergenic
965930366 3:174035440-174035462 CTGTTGTCATGTGTGGTCTGTGG + Intronic
967873206 3:194249297-194249319 TACTTTGCAGGTGTGTTCTGAGG + Intergenic
969306191 4:6327514-6327536 CAGCTTTTATGTGCGTTTTGCGG - Intronic
969442171 4:7223914-7223936 CAGTTTTCTCGTCTGTTCAGAGG + Intronic
970418694 4:15884188-15884210 CAGTTTTCAAGGTTTTTCTGGGG + Intergenic
970699239 4:18715105-18715127 CAGTTTGCCTGTGTTCTCTGTGG + Intergenic
970802982 4:19997296-19997318 AAGTGTTCATGTGTGTAATGAGG + Intergenic
971680421 4:29691909-29691931 CAGTTTTCTTGTGGGCTATGAGG + Intergenic
972682781 4:41322886-41322908 CAGTTACCATGTCTGTTATGTGG - Intergenic
972922453 4:43960593-43960615 CAGTTTAAAGGTTTGTTCTGGGG + Intergenic
974136501 4:57825165-57825187 CAGTTTTCAAGTTTACTCTGTGG + Intergenic
975401891 4:73947787-73947809 CAGGTCCCATGTGTGTTCTTTGG - Intergenic
976554229 4:86432181-86432203 CAGTTTTCAAGGTTTTTCTGGGG + Intronic
977600124 4:98927206-98927228 CAGTTTTCATTTATGTTCCTGGG - Intronic
977691405 4:99915654-99915676 CTCTCTTCCTGTGTGTTCTGTGG + Intronic
978250208 4:106621774-106621796 CAGTCTTCATGAGTGATCTTGGG - Intergenic
978257595 4:106711143-106711165 CATTTTTCATGTGTTTTTTTTGG + Intergenic
978973568 4:114840615-114840637 TAGTTTTCATATGTGTTTGGTGG - Intronic
980592283 4:134905792-134905814 ATGTTTTCATATGTATTCTGGGG + Intergenic
980760900 4:137233328-137233350 CACTTTTCTGGTGTTTTCTGTGG + Intergenic
981846024 4:149170583-149170605 CAGTTTTCATTTGTTTTAAGCGG - Intergenic
982073318 4:151714773-151714795 CACATTTCATTTATGTTCTGTGG + Intronic
983411372 4:167402801-167402823 CAGTTTTCAAGTTTACTCTGGGG - Intergenic
983470719 4:168151028-168151050 CAGTTTTCAAGATTGCTCTGGGG + Intronic
983644584 4:169976947-169976969 CATTTTTTATGTGTGTTAGGGGG + Intergenic
985393332 4:189514761-189514783 CTGTTGTCATGTGTGGCCTGTGG - Intergenic
986438973 5:7761926-7761948 TACTTTTAATGTGTCTTCTGTGG - Intronic
986683919 5:10259375-10259397 CTATTTTCATGTCTGTTCTTGGG + Intronic
986730542 5:10632079-10632101 CAGTTTTCAAGGGTTCTCTGGGG + Intronic
987922508 5:24301887-24301909 CAAATTTCATGTGGGTTCTTGGG + Intergenic
989957557 5:50374330-50374352 AAGTTGGGATGTGTGTTCTGTGG - Intergenic
990550790 5:56876194-56876216 ATGTTGTCATGTGTGTACTGTGG + Intronic
990694224 5:58396990-58397012 CAGTTTTCAAGCTTATTCTGGGG + Intergenic
990890530 5:60644406-60644428 CAGTTTTCAGGTGGGCCCTGGGG - Intronic
991620146 5:68536263-68536285 CAGTGTTCATGTTGGTACTGTGG - Intergenic
991964899 5:72081156-72081178 CAGATGTCAAATGTGTTCTGGGG - Intergenic
993333311 5:86626337-86626359 CACTTTTCATGTGTGGACAGGGG + Intergenic
994399178 5:99257287-99257309 CAGTGGGGATGTGTGTTCTGGGG + Intergenic
995337639 5:111019314-111019336 AAGTTTTCGTGTGTGTGTTGGGG - Intergenic
996087997 5:119323684-119323706 CAGTTGTAATCTGTGTTCTTTGG + Intronic
996689402 5:126322398-126322420 CGGTTTTCCTCTGTTTTCTGTGG - Intergenic
997355696 5:133261434-133261456 CAGTTTTTAAGAGTTTTCTGGGG - Intronic
997827172 5:137116761-137116783 CAGTGTGCATGTGTGTGTTGGGG - Intronic
998392620 5:141797103-141797125 CAGTGTTCAGGTGTGGTCTTTGG - Intergenic
999250004 5:150176884-150176906 CTGTTTGCATGTGTGTGTTGGGG + Intronic
999295600 5:150457884-150457906 TAGCGCTCATGTGTGTTCTGGGG - Intergenic
999823001 5:155247477-155247499 CAGTGTGGATGTGTGTTCAGAGG + Intergenic
1001647656 5:173294367-173294389 AGGTTTTCCTGTGAGTTCTGGGG + Intergenic
1003038342 6:2664455-2664477 CAGTGTGCATGCGTGTGCTGGGG - Exonic
1003685596 6:8299058-8299080 CAGTTTTCAGGTGTTATCTTTGG + Intergenic
1003940611 6:11021746-11021768 CAGTTTTCTAGTGTGTTATAGGG + Intronic
1004781729 6:18915939-18915961 TAGTTTTCATGTGTATCCTAAGG - Intergenic
1005064486 6:21805251-21805273 CATTTTTCCTGGTTGTTCTGGGG + Intergenic
1005447443 6:25939225-25939247 CAGTTTTCATTTGTCTGGTGTGG - Intergenic
1008165740 6:48135990-48136012 GATTTTTTAGGTGTGTTCTGTGG - Intergenic
1008627649 6:53333747-53333769 CAGTTTTCATGTGTGGTTTATGG + Intronic
1008677496 6:53835795-53835817 CAGTTTTCATGTGTGTTCTGTGG + Intronic
1009501208 6:64416924-64416946 CAGTTTTCCTGGGTTTACTGAGG - Intronic
1009570052 6:65373538-65373560 TAATTTTTATGTGTTTTCTGAGG - Intronic
1010466437 6:76171968-76171990 CAGATTACATGTGTGTTTTGGGG - Intergenic
1011149214 6:84251211-84251233 CAGTTTTCATCAGTGTTCCTGGG - Intergenic
1012503658 6:99919668-99919690 CAGTATACATGTTTGTTCTAAGG - Intergenic
1013793133 6:113858156-113858178 CAGGTTTCATTTGTGTTTGGGGG + Intronic
1014670347 6:124296681-124296703 ATGTTTTCAAGTGTGATCTGTGG + Intronic
1014761802 6:125364590-125364612 AGGTTTTCTTGTATGTTCTGTGG - Intergenic
1015631185 6:135233356-135233378 CATGTATCATGTGTGTTTTGTGG + Intergenic
1015721902 6:136250894-136250916 CAGTTTTCATTTCTGATTTGAGG + Intergenic
1016049180 6:139512662-139512684 CAGTTTTCAAATGAGTGCTGGGG - Intergenic
1016325647 6:142898327-142898349 CTGTGGTCATGTGTGGTCTGTGG - Intronic
1016638028 6:146317205-146317227 GAGTTTTCATGGGTCTTTTGTGG + Intronic
1016760222 6:147728445-147728467 CAGTTATCATTTGTCTCCTGAGG + Intronic
1017770798 6:157643074-157643096 CAGTTTCCCTGTGTGTTAAGAGG + Intronic
1020930288 7:14384577-14384599 AACTTTTCAGGTGAGTTCTGTGG - Intronic
1021157317 7:17226977-17226999 CAGTTATCATGTTAGTTCAGTGG - Intergenic
1022582415 7:31568942-31568964 CAGTTTTCCTCTGTGTTAAGTGG + Intronic
1025888645 7:65623636-65623658 CAGTTTTCATTTCTGTTTTAGGG + Intergenic
1027633004 7:80631182-80631204 CACTTTTCTTTTGTATTCTGGGG - Intronic
1029013235 7:97284927-97284949 CACTTTTCATGTGTGTAGTCTGG + Intergenic
1030821653 7:114099659-114099681 CAGTTTTCCTTTGGTTTCTGCGG + Intronic
1031012993 7:116543017-116543039 CAGTTTCCTTGTCTGCTCTGAGG - Intronic
1031853803 7:126898320-126898342 CAGTTTTCATTTCTGTTTTAGGG - Intronic
1033262657 7:139857040-139857062 CAGTTTTCAAGTTTACTCTGGGG + Intronic
1033785862 7:144728953-144728975 CATTTCACATGTGTGTTTTGGGG - Intronic
1035312466 7:157978152-157978174 CAGCTCTCAGGTGTGTTTTGTGG + Intronic
1035592551 8:827317-827339 GATTTTTCATGGGTGTTCTTAGG + Intergenic
1036032017 8:4984525-4984547 AAGTTTTCTTGTCTGTTCTCCGG + Intronic
1036711323 8:11080895-11080917 CAGTTTTCACGTGTGTACAGTGG - Intronic
1039173170 8:34772416-34772438 CAGTTTTACTTTGTGTTCTTGGG - Intergenic
1039336160 8:36591940-36591962 CAGTCTTCCTTTCTGTTCTGTGG - Intergenic
1040904784 8:52456442-52456464 CAATTTTCATGTATGGTGTGAGG - Intronic
1043104495 8:76090484-76090506 CAGTGGGCATGTGTGTTCAGAGG + Intergenic
1044429055 8:92087208-92087230 CATTTTTCAGCTGTGTCCTGTGG - Intronic
1044761996 8:95529404-95529426 CAGTTTTCATAAATGTTCGGTGG - Intergenic
1045169297 8:99646193-99646215 CAGTGTTCATATGTTTTCTCTGG + Intronic
1046190927 8:110792988-110793010 CTGTTTTCCTGGGTGATCTGGGG + Intergenic
1046474304 8:114720740-114720762 CATTTTTCAAGTGTGAACTGTGG + Intergenic
1047353685 8:124100024-124100046 CATTTGTGATGTCTGTTCTGAGG - Intronic
1047772021 8:128037287-128037309 CATTTTGCATGTATGTTCAGAGG + Intergenic
1049387581 8:142351763-142351785 AAGTTTTCATGTGGATTCTCTGG - Intronic
1050859746 9:10412707-10412729 CAGTTTTCAAGTGTTTTTTGAGG - Intronic
1051707328 9:19894274-19894296 TAGTTTTTCTGTGTGTCCTGAGG + Intergenic
1052665828 9:31494165-31494187 GTGTTTTCATGTGTGTTCACAGG + Intergenic
1053595846 9:39560736-39560758 CAGTTTTTATGACAGTTCTGAGG + Intergenic
1053853814 9:42317381-42317403 CAGTTTTTATGACAGTTCTGAGG + Intergenic
1054269751 9:63008888-63008910 CAGTTTTGTAGTGTATTCTGAGG + Intergenic
1054405076 9:64754443-64754465 CAGTTTTGTAGTGTATTCTGAGG - Intergenic
1054438701 9:65239935-65239957 CAGTTTTGTAGTGTATTCTGAGG - Intergenic
1054491703 9:65782011-65782033 CAGTTTTGTAGTGTATTCTGAGG + Intergenic
1060333247 9:122695047-122695069 CTGTATTCATGTGTTATCTGTGG - Intergenic
1061893909 9:133637089-133637111 CAGTGGGCATGTGTGCTCTGGGG - Intronic
1186178060 X:6945883-6945905 CAGTTTTCAAGGTTATTCTGGGG - Intergenic
1186677934 X:11839705-11839727 TAATTTTCATGTGTGGTATGTGG + Intergenic
1187505750 X:19876870-19876892 CTGTCTTCATCTGTTTTCTGGGG - Intronic
1188012952 X:25076711-25076733 CAGTTTTCTTTTCTTTTCTGTGG + Intergenic
1188251705 X:27903906-27903928 AAATGTTCAAGTGTGTTCTGTGG + Intergenic
1188941421 X:36241958-36241980 ATGTTTGCATGTGTGCTCTGTGG - Intronic
1188964079 X:36529287-36529309 CACAATTCCTGTGTGTTCTGTGG - Intergenic
1189611137 X:42737245-42737267 CATATTTCATGTGTGAGCTGAGG + Intergenic
1192905358 X:75545042-75545064 CAGTGGTTATGTGTGTTCGGAGG + Intergenic
1194528287 X:95008409-95008431 CAGTTTTCATGTATGTTAAAAGG - Intergenic
1194967916 X:100310259-100310281 GAGTTTTCATTTTTGTACTGGGG + Intronic
1196513138 X:116537728-116537750 CATCTTTCATGTGTGTTTTATGG + Intergenic
1197093838 X:122571395-122571417 AAGTGTTCATGGGTGTTGTGGGG - Intergenic
1198303094 X:135350438-135350460 CATTTTTTATGTGTCTTCTGTGG - Intronic
1199447547 X:147943621-147943643 CTTTTTTCATTTGTGTACTGTGG + Intronic
1199729133 X:150613563-150613585 CACTTTTAATGTGTGTTTTCAGG + Intronic
1200272575 X:154699542-154699564 CAGTTTCCATGACTGGTCTGTGG - Intronic
1202364360 Y:24146624-24146646 CAGTTTTCTTTTATGTTCTATGG - Intergenic
1202506421 Y:25523498-25523520 CAGTTTTCTTTTATGTTCTATGG + Intergenic