ID: 1008678487

View in Genome Browser
Species Human (GRCh38)
Location 6:53846176-53846198
Sequence CCTTCAAACACTGACTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008678483_1008678487 7 Left 1008678483 6:53846146-53846168 CCTCACTTTCTGGGCCAAGAACT 0: 1
1: 0
2: 1
3: 14
4: 238
Right 1008678487 6:53846176-53846198 CCTTCAAACACTGACTTTTGTGG 0: 1
1: 0
2: 0
3: 20
4: 222
1008678484_1008678487 -7 Left 1008678484 6:53846160-53846182 CCAAGAACTGCCAAGACCTTCAA 0: 1
1: 0
2: 0
3: 11
4: 182
Right 1008678487 6:53846176-53846198 CCTTCAAACACTGACTTTTGTGG 0: 1
1: 0
2: 0
3: 20
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008678487 Original CRISPR CCTTCAAACACTGACTTTTG TGG Intronic
902822102 1:18949697-18949719 CCTTCAAACACGGTCATGTGTGG + Intronic
904487866 1:30839639-30839661 CCTTCAAACACTAATGTGTGAGG + Intergenic
905366534 1:37454684-37454706 TCTGCAAACACTGACCTGTGGGG + Intergenic
906452130 1:45959470-45959492 CCTTCAAGCACTCACCTGTGTGG - Exonic
907952250 1:59195055-59195077 CCTTCAAAAAATGGCTGTTGTGG - Intergenic
909229625 1:73070008-73070030 TCTTTAACCACTGACTTCTGTGG - Intergenic
909873033 1:80767550-80767572 GTTTCAAAGACTGAGTTTTGGGG + Intergenic
910040089 1:82840084-82840106 CCTTCAAACACAGAATTATCTGG - Intergenic
911485841 1:98504176-98504198 CCTTGAAAAGCTGCCTTTTGTGG + Intergenic
912856977 1:113178071-113178093 CCTTCCCAGACTGATTTTTGTGG - Intergenic
916122873 1:161544534-161544556 CCTGCAATCAGGGACTTTTGGGG + Intronic
916132777 1:161625978-161626000 CCTGCAATCAGGGACTTTTGGGG + Intronic
916226441 1:162494355-162494377 CCTGCAAAGCCTGTCTTTTGTGG - Intergenic
916550431 1:165844767-165844789 CATTCAAACACTGTCCTTTTGGG - Intronic
921086736 1:211800963-211800985 CCTAAAAATACTGACATTTGGGG + Intronic
922024482 1:221738036-221738058 CCCTCAGATACTGACTTTTGGGG - Intronic
922632543 1:227131159-227131181 CCATCTAACACTGACTTCTGAGG + Intronic
923230477 1:231981871-231981893 CCTTCTAACACTCTCTTATGTGG - Intronic
923265505 1:232309866-232309888 TCTTCAAAGACTGAATTTTGTGG + Intergenic
923265761 1:232312598-232312620 TTTTAAAACACTGACTTCTGGGG - Intergenic
923668039 1:236015838-236015860 GCTTCAGACATTTACTTTTGAGG - Intronic
923682648 1:236130799-236130821 CCTTGAAACACTGCCTTTTCTGG + Intergenic
923759884 1:236832459-236832481 GCATCAAACGCTGACTGTTGAGG + Intronic
924837900 1:247672843-247672865 CCTTCTGACACTGGCTGTTGTGG - Exonic
1063019181 10:2109172-2109194 ACTTCAAACAATAACTTTTGTGG - Intergenic
1063139671 10:3245129-3245151 CCTTTAAAGACTGAATGTTGGGG - Intergenic
1064922486 10:20533582-20533604 GCTGCAAACACTGGCTTTTCTGG - Intergenic
1068711896 10:60144176-60144198 CCTTAAATCACTGAGTTTCGGGG + Intronic
1071316456 10:84404636-84404658 CTTTTAAAAATTGACTTTTGAGG - Intronic
1072477828 10:95780267-95780289 CCGTCAAACATTAATTTTTGTGG + Intronic
1073416248 10:103385374-103385396 CCTTCAAACATTTACTTGTTTGG + Exonic
1074993390 10:118732557-118732579 CCTTCAACCAATGACTACTGAGG + Intronic
1076657561 10:132035172-132035194 CCTTCAAAATATGAATTTTGGGG - Intergenic
1079691035 11:23417183-23417205 GCTTCAACCAATGAATTTTGTGG + Intergenic
1083995170 11:66268040-66268062 CCCTAAAACACTCACTTGTGGGG + Intergenic
1088942417 11:114473317-114473339 CCTTAACACACTGATTATTGTGG - Intergenic
1089175249 11:116544273-116544295 CATTGAAACACTGACTCTTTCGG + Intergenic
1089211280 11:116804849-116804871 CCTAAAGAAACTGACTTTTGGGG + Intergenic
1089724102 11:120458776-120458798 CCTATAAACACTCACTTCTGGGG - Intronic
1089940488 11:122411332-122411354 CCTTGAAAAGCTGCCTTTTGTGG + Intergenic
1089941148 11:122418849-122418871 CCCTGAAAAGCTGACTTTTGTGG + Intergenic
1090535371 11:127635465-127635487 CCAACAAAGACTGACTCTTGTGG + Intergenic
1091830844 12:3550290-3550312 CTTACAACCACTGACATTTGCGG + Intronic
1092031678 12:5291543-5291565 ACTTCAACCTCTGAATTTTGGGG - Intergenic
1092275316 12:7056442-7056464 GCTTCAAAGACTGAGTTCTGAGG - Intronic
1092330347 12:7581293-7581315 TCTCCAAACTCTGTCTTTTGAGG - Intergenic
1093427892 12:19049955-19049977 TATTTAAACAGTGACTTTTGAGG - Intergenic
1094004564 12:25735478-25735500 CCTTACACCACTGACCTTTGTGG - Intergenic
1094303092 12:28988158-28988180 CTTTCTAGCGCTGACTTTTGAGG + Intergenic
1094596303 12:31869837-31869859 CCTCTGAACACTGATTTTTGGGG + Intergenic
1095050046 12:37546909-37546931 CCTTCAAGCACTGAATCTTTTGG + Intergenic
1095517612 12:43023823-43023845 CCTTCTAAGAGTGACTATTGTGG + Intergenic
1095900375 12:47321603-47321625 CCTACAGATACTGACATTTGAGG + Intergenic
1097970901 12:65632140-65632162 CTTTAAATCACAGACTTTTGGGG - Intergenic
1098052501 12:66469494-66469516 CCTTTAAAGACTGAGTTTGGAGG + Intronic
1101015283 12:100494185-100494207 CCTTCATACATTGAACTTTGAGG - Intronic
1101731607 12:107431656-107431678 ACTGCAAACTGTGACTTTTGTGG + Intronic
1104522384 12:129487569-129487591 ACTTTCAACACTGACTTTGGAGG - Intronic
1105212160 13:18263363-18263385 CCTTCCAGTTCTGACTTTTGAGG + Intergenic
1106345980 13:28878173-28878195 CTTTCAAACATTGAGCTTTGTGG + Intronic
1106496208 13:30278830-30278852 TCTTAAAACACTGCCTTTTGAGG + Intronic
1106548738 13:30753124-30753146 TCTTCATTCACTGACTTCTGTGG - Intronic
1106864286 13:33947163-33947185 CCTTGACACATTGACATTTGGGG - Intronic
1106935169 13:34710486-34710508 CCTTGAGCCACTGCCTTTTGGGG + Intergenic
1107418712 13:40225252-40225274 CCTTGAAACACTTTCTTTTGCGG - Intergenic
1107642238 13:42455218-42455240 TCTTGAAACACTGAGATTTGGGG - Intergenic
1108764484 13:53610055-53610077 CCAGCAAACACAGACTTCTGTGG + Intergenic
1108915744 13:55608786-55608808 CTCTCAATCATTGACTTTTGGGG - Intergenic
1109141558 13:58718602-58718624 CCTTGAAAAGCTGCCTTTTGTGG + Intergenic
1110715009 13:78692064-78692086 TCTTGAAAGACTGACTTTTTTGG - Intergenic
1113403890 13:110020486-110020508 CCTTGCAACACAGACCTTTGTGG + Intergenic
1113733465 13:112658442-112658464 CTTTCAAACTCAGAGTTTTGAGG - Intronic
1116805754 14:49492710-49492732 CCTTCGAATACTGAATTCTGGGG + Intergenic
1118343076 14:64912493-64912515 CCTTTAACCACTCACTTCTGTGG + Intergenic
1118488990 14:66241008-66241030 CCTTCTAACCCTGATTTTTGAGG + Intergenic
1129995606 15:80002696-80002718 ATTTCCAACACTGACTTTTAAGG - Intergenic
1130931241 15:88429651-88429673 CTTTCAAAGACTGCCTTTTAGGG + Intergenic
1132335032 15:101042779-101042801 CCTTCAAATTCTCACTTTTGAGG + Intronic
1134605813 16:15570385-15570407 CCTTCAACTATTGACATTTGGGG + Intronic
1135036884 16:19086125-19086147 ACTTCTAACACAGGCTTTTGGGG + Intergenic
1135466176 16:22686838-22686860 CCTTAAAAAACAGCCTTTTGAGG + Intergenic
1137397323 16:48125342-48125364 CCCTCAAACAATGACTGCTGGGG - Intronic
1140106701 16:71967236-71967258 CGTTCAAAGACTGTCTTCTGGGG + Exonic
1140694051 16:77514203-77514225 ACTTCAACCTATGACTTTTGAGG + Intergenic
1140752230 16:78035410-78035432 CCTCCAAATACTAAATTTTGGGG - Intronic
1141748095 16:85939508-85939530 CTTTTAAACACTGAAATTTGTGG + Intergenic
1142945047 17:3419531-3419553 CCTTCAACAACTCATTTTTGTGG - Intergenic
1143222616 17:5275289-5275311 CCTTCACAGACTGACTTCTATGG + Intergenic
1143291132 17:5830023-5830045 CCTTGGAACACTGACTTTGTTGG + Intronic
1144630450 17:16869448-16869470 CCTTGAAGCACTGTCATTTGGGG + Intergenic
1145001647 17:19309427-19309449 CATTCAAGAGCTGACTTTTGAGG - Intronic
1146138846 17:30347291-30347313 CCTCCAAACCCTGTCCTTTGGGG - Intergenic
1148982490 17:51590580-51590602 CCTTTCAAGACTGAGTTTTGGGG - Intergenic
1149233667 17:54566071-54566093 CCTTTAAAGGCTGACTTGTGTGG + Intergenic
1150334484 17:64320544-64320566 GCTTCCAACACAGACTTTGGGGG - Exonic
1151366735 17:73622518-73622540 TCCTCAAACACTGAATTGTGGGG - Intronic
1152230096 17:79110053-79110075 CCTTCCCACACTGACTGTAGCGG + Intronic
1156086630 18:33413845-33413867 TCTTGAAATACAGACTTTTGGGG - Intronic
1157358044 18:46953303-46953325 CCCTGTATCACTGACTTTTGAGG - Intronic
1157375697 18:47162219-47162241 CCTCCCAATACTGACATTTGGGG + Intronic
1157605043 18:48921066-48921088 CCTTCATACACTGTGTTTGGTGG + Exonic
1157943019 18:51949834-51949856 GTTTCAGACACTGAGTTTTGGGG + Intergenic
1159799316 18:72878273-72878295 CCTTCAAACAATGACTGCTGGGG + Intergenic
1160094354 18:75858033-75858055 CTTTAAAACACTGACATTGGTGG - Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1162646436 19:12053414-12053436 CCTTGCAAAACTGTCTTTTGAGG + Intergenic
1165609836 19:37141841-37141863 GCTTCAACCTCTGAATTTTGGGG + Intronic
1165932989 19:39372407-39372429 CCTTCACACACTGAGGTCTGAGG - Intronic
1167581845 19:50349517-50349539 CCTTATAACACGGACTTGTGTGG - Intronic
1167769137 19:51502878-51502900 TCTTGAAACAATGATTTTTGGGG + Intergenic
1168118328 19:54238650-54238672 CCAGCAAACACTAACTCTTGAGG - Exonic
1168123294 19:54267108-54267130 CCAGCAAACACTAACTCTTGAGG + Intronic
925098632 2:1227662-1227684 CCTTCAAGCCCTAACTTTGGTGG - Intronic
925517600 2:4701226-4701248 GCTTGAAAGACTGTCTTTTGAGG + Intergenic
926336963 2:11870984-11871006 CCATCAAACACTAGTTTTTGAGG - Intergenic
927512146 2:23650515-23650537 CCAGCAAACACTGACTGATGAGG - Intronic
928725308 2:34165838-34165860 CCTTCTAACACTGAAGTCTGTGG + Intergenic
930298985 2:49591949-49591971 CCTTAATAAACTGATTTTTGTGG + Intergenic
930833251 2:55768207-55768229 TCTTAAAACACTGAGTGTTGGGG - Intergenic
931561299 2:63564064-63564086 CCACCAAACATTAACTTTTGGGG + Intronic
931919010 2:66992251-66992273 CCTTAAAACACTGAGTATGGAGG - Intergenic
932162826 2:69478144-69478166 CTTGCAAGGACTGACTTTTGAGG + Intronic
933468542 2:82689055-82689077 TCTTCTAACACTAATTTTTGAGG + Intergenic
933793121 2:85899423-85899445 TCTTCAAACACTAGCTTTTCTGG + Intergenic
933794778 2:85910861-85910883 TTTTCAGACACTGACCTTTGGGG - Intergenic
934301465 2:91779040-91779062 CCTTCCAGTTCTGACTTTTGAGG - Intergenic
935735675 2:106105071-106105093 CCTTCAGGCACTGTCTTTTGAGG - Intronic
937588447 2:123585293-123585315 CCTTCAAATATTGAATATTGGGG + Intergenic
937821670 2:126317549-126317571 GCTTCAAACAATGACTTCAGTGG - Intergenic
938684669 2:133726543-133726565 CATTTAAAAACTGATTTTTGGGG - Intergenic
938748845 2:134308928-134308950 TATTCTAACACTGACTATTGTGG - Intronic
939225928 2:139364202-139364224 CCTCCTAACACTGACATTTTGGG - Intergenic
944504377 2:200394950-200394972 CCTTCACAGAGTGACATTTGGGG - Intronic
945385297 2:209191379-209191401 CCTCCCAACACTGCCTCTTGGGG + Intergenic
945804449 2:214473324-214473346 CCTTCAACCACTGAAAATTGGGG - Intronic
946728816 2:222688968-222688990 TTTTTAAACACTTACTTTTGAGG + Intronic
947700432 2:232229904-232229926 TCTTCAAATCCTGACCTTTGGGG + Intronic
1169672434 20:8117608-8117630 TCTTAAACCACTGAGTTTTGGGG - Intergenic
1171544567 20:25990423-25990445 CCTTCAAGCACTGAATCTTTTGG + Intergenic
1173340440 20:42148348-42148370 CCTTCCAAATCTGACTTTTGAGG - Intronic
1174038256 20:47681447-47681469 TCTACAAACACTGACATTGGGGG - Intronic
1177149012 21:17436105-17436127 CCTCCAGACACTCACTTTAGTGG - Intergenic
1179062357 21:37990723-37990745 CTTTCAGACACTGTCATTTGAGG - Intronic
1180814971 22:18783683-18783705 CCTTCCAGTTCTGACTTTTGAGG + Intergenic
1181201159 22:21218019-21218041 CCTTCCAGTTCTGACTTTTGAGG + Intronic
1181700583 22:24618948-24618970 CCTTCCAGTTCTGACTTTTGAGG - Intronic
1182245519 22:28954483-28954505 GCTTCAAAATATGACTTTTGGGG + Intronic
1184064841 22:42112483-42112505 CCTTCAACTCATGACTTTTGAGG - Intergenic
1185416939 22:50715660-50715682 CGTTCAAACAATGACTGTGGGGG - Intergenic
1203225754 22_KI270731v1_random:77412-77434 CCTTCCAGTTCTGACTTTTGGGG - Intergenic
1203265074 22_KI270734v1_random:9372-9394 CCTTCCAGTTCTGACTTTTGGGG + Intergenic
949802517 3:7919167-7919189 ACTTAAAACCCTGACGTTTGGGG - Intergenic
952445543 3:33377656-33377678 CCTGCAAACACTGACCACTGGGG + Intronic
954102376 3:48384950-48384972 ACTTCATACACTTACTTTTGTGG + Intronic
954313482 3:49787626-49787648 CCTTAAAACACTAACTTTGGTGG + Intergenic
954804489 3:53209157-53209179 TCTTAAAACACTGAATTTTGGGG - Intergenic
955353919 3:58215005-58215027 CCTTCAGAAAGTGACTCTTGAGG - Intergenic
955819784 3:62884165-62884187 CATTCAAACATTGCTTTTTGAGG + Intergenic
957791578 3:84948558-84948580 CCTTCAATGACTCACTTTGGTGG - Intergenic
958045272 3:88277005-88277027 CTTTCAAACACTGGCTATTTTGG + Intergenic
958606182 3:96361328-96361350 TCTTCAAACCCTGTCCTTTGGGG + Intergenic
961394312 3:126576327-126576349 CCTTGAAAGACTGCCTTTTCCGG - Intronic
961643033 3:128376684-128376706 CCTTGGCACACTGACTTGTGTGG + Intronic
961958294 3:130827062-130827084 TCTTTAAAAACTGAGTTTTGAGG + Intergenic
963077538 3:141361211-141361233 TCTAAAAACACTGACTTTTATGG - Intronic
963349819 3:144138617-144138639 CCTGCATACACTGACATCTGAGG - Intergenic
963933616 3:151029609-151029631 TCTTCAACTACTGAGTTTTGAGG - Intergenic
964240344 3:154585543-154585565 TCTTCAAACCCTGTCCTTTGGGG - Intergenic
964517548 3:157529120-157529142 GCTTCAAATGCAGACTTTTGGGG + Intronic
965226202 3:165995071-165995093 CACTCAAACTCTGACTTGTGAGG + Intergenic
969194405 4:5549009-5549031 CCTTCAATCACTGTCTATTCAGG - Intronic
969851158 4:9957323-9957345 CATTCACACACTGACTTGTGGGG + Intronic
969903242 4:10369472-10369494 TCTTCAAGTACTGACTGTTGAGG + Intergenic
970077929 4:12246025-12246047 CCTTCAGACACTGACATTCCTGG + Intergenic
973296383 4:48526557-48526579 CCTTCAAACACTGCTGTGTGTGG + Intronic
973565783 4:52185889-52185911 AGGTCAAACACAGACTTTTGTGG + Intergenic
973760497 4:54110235-54110257 CCCTCGGACACTGACCTTTGTGG + Intronic
974103242 4:57440326-57440348 CCTTCACCAACTAACTTTTGAGG + Intergenic
975836518 4:78428050-78428072 CCCTCCAAAACTGGCTTTTGGGG + Intronic
976319485 4:83696714-83696736 CATTCTTACACTAACTTTTGGGG - Intergenic
977807048 4:101313166-101313188 CCTTCAAGAACTCAGTTTTGTGG - Intronic
980348351 4:131654022-131654044 GTATCAAACACTGACTTTTCTGG - Intergenic
980423570 4:132595179-132595201 GTTTCAAACACTGACTTCTTGGG + Intergenic
980617253 4:135245466-135245488 CTTTCAAATATTCACTTTTGAGG - Intergenic
980866220 4:138556320-138556342 CCTTCAGAAAGTGACTTTAGTGG - Intergenic
982017181 4:151166260-151166282 CCTTCAAATATTTAATTTTGGGG + Intronic
983887146 4:172993130-172993152 TCTTCAAACACAGACAATTGGGG - Intronic
984027628 4:174563200-174563222 GCTTCAAACTATGACTTTTCTGG - Intergenic
985166209 4:187097490-187097512 ACTTCCCACACTCACTTTTGAGG + Intergenic
985273086 4:188212985-188213007 TCTTAAAACACTAACATTTGTGG + Intergenic
992044579 5:72872943-72872965 TCTACAAACACTGATTTTGGTGG + Intronic
992481105 5:77153162-77153184 CCTTGGCACACTGACATTTGGGG - Intergenic
992882291 5:81122323-81122345 CCTTCCATTACTGAATTTTGGGG + Intronic
994074326 5:95633985-95634007 CTTTAAGCCACTGACTTTTGTGG + Intergenic
995294339 5:110501775-110501797 GCTTCAACCAGTGATTTTTGAGG - Intronic
995687699 5:114788985-114789007 CCTTCAAGCTCTGCCTCTTGAGG - Intergenic
997277811 5:132612471-132612493 CGTTTAAACAGTGAATTTTGTGG + Intronic
998027297 5:138829427-138829449 ACTTCAAAAACAGACTTTGGTGG + Intronic
998417921 5:141958967-141958989 CCTGCCCACACTGACTTATGAGG + Exonic
999325881 5:150643026-150643048 CCTTCATATTCTGACATTTGAGG + Intronic
999536695 5:152525083-152525105 CCTAAAAGCACTGACATTTGGGG - Intergenic
999622762 5:153489610-153489632 CCTTCAAAAACTGTATTCTGTGG + Intronic
1005317299 6:24616081-24616103 CCTACAAACAATGTCTTCTGTGG - Intronic
1008380955 6:50839425-50839447 CCTTTAAACACAGCCTTTTGGGG - Intronic
1008678487 6:53846176-53846198 CCTTCAAACACTGACTTTTGTGG + Intronic
1008903973 6:56655973-56655995 GCTTAAAACATTAACTTTTGAGG + Intronic
1010908508 6:81522975-81522997 TCTCCAAACACTGTCCTTTGAGG - Intronic
1012175679 6:96079268-96079290 CCTTCAAATACTGAGCTTTTTGG + Intronic
1012233396 6:96785993-96786015 CCTCCATTGACTGACTTTTGGGG - Intergenic
1015377832 6:132530793-132530815 TCTTCAAATACTAATTTTTGAGG - Intergenic
1018234404 6:161709964-161709986 CCATGAAGCACTGACTGTTGAGG - Intronic
1018428447 6:163704050-163704072 CTTTCAGTCACTGACTTTTGGGG - Intergenic
1025295955 7:57775488-57775510 CCTTCAAGCACTGAATCTTTTGG + Intergenic
1025982761 7:66420747-66420769 CCCACAAAAACTGACTTTTTGGG - Intergenic
1028449602 7:90966434-90966456 CCTTCAGATACTGACATCTGAGG - Intronic
1029139848 7:98401535-98401557 CCTTCAAGCCCTGCGTTTTGGGG + Intergenic
1030474003 7:110005028-110005050 GCTTAAAACACAGATTTTTGTGG - Intergenic
1032515827 7:132505399-132505421 TCTTAAAACCCTGACTTTTTGGG - Intronic
1034226204 7:149485463-149485485 CCTTCAGAAATGGACTTTTGTGG - Intronic
1036216608 8:6884739-6884761 CCTTCAAACACAGCCTCTCGTGG - Intergenic
1037613495 8:20496044-20496066 CCCTCAATCACTCAGTTTTGGGG - Intergenic
1040900463 8:52412643-52412665 CATTAAAACACAGACCTTTGGGG + Intronic
1045941399 8:107742987-107743009 CCTTAAAACACAGAGTTATGGGG + Intergenic
1047280176 8:123438764-123438786 GGTTCAAACTCTGATTTTTGAGG + Intronic
1047897099 8:129378399-129378421 CCCACAAGCTCTGACTTTTGGGG - Intergenic
1053442363 9:38126971-38126993 CCATCGACCACTGGCTTTTGTGG - Intergenic
1053536989 9:38936020-38936042 CCTTCAAGGAGTGACTTTTTGGG - Intergenic
1054629147 9:67427910-67427932 CCTTCAAGGAGTGACTTTTTGGG + Intergenic
1054961127 9:70970831-70970853 TCTTCAAACATTCTCTTTTGGGG - Intronic
1055251880 9:74317415-74317437 CCTTCAAACAATGACTGATGTGG + Intergenic
1055278444 9:74646386-74646408 TATTCAAAAACTGACTTTTTGGG - Intronic
1059067497 9:111100852-111100874 AGGTCAATCACTGACTTTTGTGG + Intergenic
1059590858 9:115659964-115659986 CCTTTCAACTCTGACATTTGGGG + Intergenic
1059636103 9:116172205-116172227 GCTTCTACCACTGACTTGTGTGG - Intronic
1062186467 9:135221167-135221189 CCTTCCTGCACTGCCTTTTGGGG - Intergenic
1062244224 9:135555670-135555692 GCTTCAAACAATGATTTCTGAGG - Intergenic
1186585341 X:10867360-10867382 ACTTCAAAGACTGGCTTTGGTGG + Intergenic
1187381509 X:18805949-18805971 CCTTAAAGCACTGACTTTCTGGG + Intronic
1188421454 X:29994839-29994861 GGTTAAACCACTGACTTTTGGGG - Intergenic
1192063660 X:67857817-67857839 CCTTGCAAAGCTGACTTTTGTGG - Intergenic
1196978760 X:121188447-121188469 CATTCCAACACTGGCTTTTGTGG - Intergenic
1198772828 X:140149084-140149106 CCTTCAACATATGACTTTTGAGG - Intergenic
1200172965 X:154091965-154091987 CCTACACACACTGACCTTTCAGG + Intronic