ID: 1008680703

View in Genome Browser
Species Human (GRCh38)
Location 6:53868839-53868861
Sequence ATTTGATGCACAGTGATGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008680703 Original CRISPR ATTTGATGCACAGTGATGAG AGG (reversed) Intronic
900876225 1:5344489-5344511 AGTTGAAGGACAGTGGTGAGAGG - Intergenic
904375874 1:30082181-30082203 ATTTTATGAACAATGTTGAGTGG - Intergenic
905645997 1:39625615-39625637 ATTGGGTGCACAGTGCAGAGGGG - Exonic
906952364 1:50345201-50345223 ATTTGTTGCAGGGTGAGGAGAGG + Intergenic
911353799 1:96791199-96791221 ATTTCATACACAGTGATGAAGGG + Intronic
916266271 1:162892573-162892595 TTTTAATGCCCAGTGAGGAGAGG + Intergenic
916525042 1:165601775-165601797 ATTTGATGAGAAGTGATAAGTGG + Intergenic
917625413 1:176841083-176841105 ATTTAATGCAGAGTGCTCAGGGG + Intronic
924556971 1:245126692-245126714 ATTTGAATCAGAGTGATGAGGGG - Intronic
1066657479 10:37709726-37709748 ATTTGAACCTCAGTGCTGAGAGG - Intergenic
1068090085 10:52422847-52422869 AAATGATGCACAGTGAACAGAGG + Intergenic
1068952355 10:62790110-62790132 ACTGAATGCACAGTGAGGAGGGG + Intergenic
1074946862 10:118288450-118288472 ATCTGATGTGCAGTGATGGGAGG + Intergenic
1077884041 11:6372690-6372712 ATTTGAAGCAGGGTGATTAGGGG - Intergenic
1080487273 11:32722443-32722465 ATCTGACTCACAGTCATGAGAGG + Intronic
1080824644 11:35837595-35837617 CTTTGAGGCACAGAGATGTGTGG + Intergenic
1081838331 11:46176213-46176235 ACTTTATGCACAGTGATGAGGGG - Intergenic
1082688608 11:56271906-56271928 ATTGGCTACAAAGTGATGAGAGG - Intergenic
1084747210 11:71180705-71180727 ATTTGATCCACATTGGTGTGTGG - Intronic
1085474399 11:76780909-76780931 ACTGGAGGCACAGTGATGAGGGG + Intergenic
1089913899 11:122132701-122132723 TTTTGATGGACAGAGATGAGGGG - Intergenic
1091344163 11:134841785-134841807 ATTTGATTTTCAGTGATGTGTGG + Intergenic
1091415700 12:281393-281415 ATTTGTTGCATAGTGGTGACTGG + Exonic
1091540994 12:1462225-1462247 CTCTGATACACTGTGATGAGAGG + Intronic
1093505192 12:19857127-19857149 ATTTAAAGTGCAGTGATGAGGGG + Intergenic
1094258167 12:28459706-28459728 ATTTGCTCTACAGTGATGAATGG + Intronic
1098533921 12:71573612-71573634 TTTTGATGAACGGTGATGATAGG + Intronic
1098761154 12:74427192-74427214 ATTTGATCCCCAGTGTTGGGAGG + Intergenic
1098832956 12:75385565-75385587 AGTTGAAGAGCAGTGATGAGAGG - Intronic
1099651424 12:85433310-85433332 CTCTGATGGACAGTGATGATGGG + Intergenic
1101651722 12:106683219-106683241 ATGTGCTGCCCAGGGATGAGAGG - Intronic
1101791538 12:107932121-107932143 ATTTGATTGACAGTGAGGTGTGG + Intergenic
1103310609 12:120004245-120004267 ACTTGTAGCACTGTGATGAGGGG - Intronic
1103899833 12:124297656-124297678 ATTAGCTGCACAGTGAAAAGGGG - Intronic
1108735440 13:53278884-53278906 ATTTCATGCATAATGGTGAGAGG + Intergenic
1109884201 13:68522397-68522419 CTCTGATACACAGTGATGTGGGG + Intergenic
1113989650 13:114350836-114350858 ATTTGAGGTGCAGTGGTGAGTGG + Intergenic
1114053608 14:18944879-18944901 ATCTGATGCACAGAGTTTAGTGG + Intergenic
1114108948 14:19457046-19457068 ATCTGATGCACAGAGTTTAGTGG - Intergenic
1115061575 14:29197702-29197724 ATTTGATGCACAGTTGTAACTGG - Intergenic
1115891575 14:38035709-38035731 ATTTGAAGCCCAGGGATCAGTGG + Intronic
1119603095 14:75990657-75990679 ATTGGAGGCACAGTTAGGAGAGG + Intronic
1127246488 15:57181153-57181175 ATTTGATGTGAAGTTATGAGTGG + Intronic
1128666059 15:69539169-69539191 ATATGATGCTCTGTGATGAAGGG - Intergenic
1130807404 15:87340349-87340371 AGTTGAGGAACAGTGTTGAGAGG - Intergenic
1132400575 15:101502345-101502367 TTTTGATGCCTACTGATGAGGGG + Intronic
1134654738 16:15939649-15939671 ATTTGATGTACAGTTTTGAAAGG - Intergenic
1141906709 16:87031510-87031532 ATTTGATGCAAAGTGTAGACAGG - Intergenic
1144709152 17:17388908-17388930 ATTTGAACCACAGAGATGAGTGG + Intergenic
1147006179 17:37406300-37406322 AATTGAGGCGCAATGATGAGAGG - Intronic
1149466599 17:56884692-56884714 ATCTGGGGCACAGTGAGGAGTGG + Intergenic
1149559165 17:57595908-57595930 AGTAGATGCACAGTGAGAAGTGG + Intronic
1153440111 18:5107758-5107780 ATTTGTTGCACAGGGGAGAGAGG - Intergenic
1153907456 18:9675114-9675136 ATTTGGAGCACAGTGAGGAGTGG + Intergenic
1156151347 18:34247022-34247044 AATTGAAGCACAGTGAACAGTGG - Intergenic
1156793356 18:41007046-41007068 ATTTGATACTCAGTTATGAAAGG - Intergenic
1156885091 18:42126016-42126038 ATTTAATGCCCAGTAGTGAGAGG + Intergenic
1157290660 18:46407161-46407183 ATTTGAGGCACTGGGATCAGTGG + Intronic
1159776075 18:72604320-72604342 ATTTCCTGCACAGTAAGGAGTGG + Intronic
1162155636 19:8676579-8676601 GTTTGATGCCCAGTGAAGATTGG - Intergenic
1164544259 19:29146023-29146045 ATTTGACACTCAGTGAGGAGAGG - Intergenic
1168357103 19:55707697-55707719 ATTTGATGCTCAGTCAAGATGGG - Intronic
925095963 2:1202980-1203002 ATTTTATGCTCAGTGTTGATAGG + Intronic
925732352 2:6928439-6928461 ATTTGATTCCCAGTGAAGACTGG + Intronic
926233316 2:11021168-11021190 ATTTGATCTTCAGTGTTGAGAGG - Intergenic
926458096 2:13093818-13093840 TGTTGATGCAGAGTGATGTGTGG + Intergenic
927323349 2:21774187-21774209 ATTTGATGCAAAGTTATTACTGG + Intergenic
927386626 2:22541647-22541669 ACTTGAGGCACAGAGAAGAGAGG - Intergenic
927978951 2:27360895-27360917 GTTTCATGTTCAGTGATGAGTGG - Intergenic
928786949 2:34899424-34899446 ATTTCATGGACATTGATTAGTGG - Intergenic
928976834 2:37096544-37096566 ATTTGTTCCAAAGTGAAGAGGGG - Exonic
930210799 2:48635023-48635045 GTTCTCTGCACAGTGATGAGGGG + Intronic
930293062 2:49519855-49519877 ATCTGATGACCAGTGATGATGGG - Intergenic
935424031 2:102900648-102900670 ATTTGGTGCACAGTCCTGGGAGG + Intergenic
936923790 2:117715956-117715978 ATATCATGCACAGTGGTGAGGGG - Intergenic
936983065 2:118281960-118281982 CTGTGATGCACAGAGAAGAGTGG - Intergenic
937290231 2:120777603-120777625 TTTGGAGGGACAGTGATGAGTGG + Intronic
938471570 2:131567378-131567400 ATCTGATGCACAGAGTTTAGTGG + Intergenic
939661206 2:144892212-144892234 AATTAATACACAGTGGTGAGTGG + Intergenic
940106097 2:150102055-150102077 ATTAGATGCATAGTGATCAGAGG - Intergenic
941107473 2:161373477-161373499 ATCTGATTCATAGAGATGAGAGG - Intronic
941271634 2:163436980-163437002 TTTTAATGCACAGTGAAGTGTGG - Intergenic
944122965 2:196261016-196261038 ACTTGGTGCAAAGTGATCAGAGG + Intronic
945623993 2:212177333-212177355 ATTTGATGCATAGTTCTTAGTGG - Intronic
948761967 2:240197925-240197947 AAGTGATGGACAGTGATGAATGG - Intergenic
1170892525 20:20388213-20388235 ATTTCTTGCAGAATGATGAGAGG - Intergenic
1172030154 20:31976187-31976209 AATTGAGGCACAGAGAAGAGTGG + Intronic
1172211222 20:33199840-33199862 ATTGGATGCTCACTGAGGAGAGG - Intergenic
1172964656 20:38825961-38825983 ACTTGGTGCACTGTGAGGAGAGG - Intronic
1175155250 20:56966967-56966989 ATTTGATGCACATAGAGGGGAGG - Intergenic
1180281222 22:10698592-10698614 ATTTGGTAGACAGTGAAGAGAGG - Intergenic
1180472077 22:15667260-15667282 ATCTGATGCACAGAGTTTAGTGG + Intergenic
1182903412 22:33918035-33918057 AGTTGATGCACAGTGCAGGGAGG - Intronic
1203288699 22_KI270735v1_random:11879-11901 ATATGATACACATTTATGAGAGG - Intergenic
950938228 3:16865489-16865511 AGTTGATGCCCAGTAATAAGTGG - Intronic
951106328 3:18747554-18747576 ACTTGATGCACAGTGAGGTTAGG + Intergenic
952096093 3:29956272-29956294 ATTTGATCCACAGAGATGGCAGG - Intronic
953403779 3:42650177-42650199 TTCTGATTCACAGTGAGGAGTGG - Intergenic
956845877 3:73182197-73182219 ATTTGTTCCAAAGTGAAGAGGGG + Intergenic
959093634 3:101930224-101930246 ATTTTATAGAGAGTGATGAGTGG + Intergenic
961602593 3:128072899-128072921 AACTAATGCACAGTGATGGGGGG + Intronic
963039478 3:141058199-141058221 ATATGATGCACAGTCTTCAGAGG - Intronic
963818329 3:149858777-149858799 ATTTAATGAATAATGATGAGGGG - Intronic
963979920 3:151526052-151526074 CTAAGATGCTCAGTGATGAGGGG - Intergenic
964868934 3:161291840-161291862 ATTTCAATCTCAGTGATGAGAGG - Intergenic
967182723 3:186920364-186920386 ATTGGAGGCAAAGTGAGGAGAGG - Intergenic
967839066 3:193989892-193989914 ATATGATACTCAGTGATTAGTGG + Intergenic
973095152 4:46188279-46188301 ATTTGATAGACAGTGATTAAAGG + Intergenic
973165264 4:47069668-47069690 TTTTGATGGACAGGAATGAGAGG - Intronic
973286648 4:48425585-48425607 ATTAGATTAATAGTGATGAGAGG + Exonic
973607120 4:52599180-52599202 ATTTGATGGAAAGTGAAGGGAGG + Intronic
974765749 4:66343341-66343363 ATTTTATGCACATTGGTGATCGG + Intergenic
982179219 4:152734353-152734375 ATTAGATGCCCAGGGATGAGAGG + Intronic
984514826 4:180725193-180725215 ATTTGATGCACATGAATGAAAGG - Intergenic
990730590 5:58804466-58804488 ATTTAATGCTCAGTCCTGAGTGG - Intronic
991884628 5:71249218-71249240 ATTTTAAGCACAATTATGAGAGG - Intergenic
993118090 5:83741681-83741703 ATTTGATGAGCAGTGATGTGTGG + Intergenic
995290104 5:110442330-110442352 ATTTGAAAATCAGTGATGAGAGG - Intronic
995658524 5:114454231-114454253 AGATGATGTAGAGTGATGAGGGG - Intronic
997907577 5:137834749-137834771 ATTTGATGTACAATTATTAGTGG + Intergenic
999006379 5:147984647-147984669 ATTTTATACACAGTGATTAAGGG + Intergenic
999498186 5:152120617-152120639 ATTTCATGCAGAGTGATAAAAGG + Intergenic
999638233 5:153644670-153644692 ATGTGATACAGACTGATGAGGGG + Intronic
999704786 5:154262313-154262335 ATTTGAAGCACTGAGCTGAGAGG - Intronic
1002518728 5:179778219-179778241 GTGAGATGCACAGTGCTGAGCGG + Intronic
1005621544 6:27625081-27625103 AATTACTCCACAGTGATGAGAGG + Intergenic
1006621555 6:35368318-35368340 TTTTGATGCACAGTGCTCACTGG + Intronic
1008680703 6:53868839-53868861 ATTTGATGCACAGTGATGAGAGG - Intronic
1009440224 6:63669072-63669094 ATTTGATACACACTGGTGACAGG + Intronic
1009943152 6:70312974-70312996 ATTAGATGCAGAGTGAAGCGGGG - Intergenic
1010379624 6:75209247-75209269 ATTTGATTCTCAGGGCTGAGAGG + Intergenic
1011160971 6:84390124-84390146 CTCTGATGGACAGTGGTGAGGGG - Intergenic
1013280748 6:108634645-108634667 ATTTGTTTCAGAGTGATTAGAGG + Intronic
1013861907 6:114645796-114645818 ATCTGATTCACAGTAAAGAGAGG - Intergenic
1014013772 6:116506266-116506288 CTCTGATGAACAGTGATGATGGG - Intronic
1014053266 6:116981565-116981587 AATTGTTGCACGGGGATGAGGGG + Intergenic
1015862450 6:137695133-137695155 ATTTGGTGCACTGAGAAGAGAGG + Intergenic
1016098976 6:140074287-140074309 AATTGATGCAGAGTGAGGACTGG - Intergenic
1016926272 6:149351761-149351783 ATTTGATACACAGTGATAGCTGG - Intronic
1019138359 6:169926748-169926770 ATTTGGTTCTCAGTGATGAAAGG + Intergenic
1019235282 6:170606935-170606957 ATTTGAGGTGCAGTGGTGAGTGG + Intergenic
1020640896 7:10752468-10752490 CTTTGATGGCCAGTGATGATGGG - Intergenic
1021219157 7:17955105-17955127 ATTTGAGCAACAGTGATTAGTGG + Intergenic
1022183809 7:27947738-27947760 CTTTGATCCACAGTGAGGAAGGG - Intronic
1026155672 7:67823600-67823622 AACTGATTCACAGAGATGAGGGG + Intergenic
1028631573 7:92940359-92940381 AAATGCTGCACAGTGATGTGTGG + Intergenic
1029908859 7:104122297-104122319 TGTTGATGCACAGTAATGATGGG - Intergenic
1033809530 7:144994955-144994977 ATTAGTTGCACAGTTATCAGTGG + Intergenic
1035851838 8:2927751-2927773 ATTTGTTTCACAGTCATGACTGG - Intergenic
1038220252 8:25600327-25600349 ATTTGATGCCCAGGGGTGGGTGG + Intergenic
1041559522 8:59199295-59199317 ACTTGATACAATGTGATGAGTGG + Intergenic
1042884975 8:73539030-73539052 ATTTGATGGAGAGTCAGGAGAGG + Intronic
1043871869 8:85442060-85442082 ATCTGAATCACAGTGCTGAGAGG + Exonic
1044591317 8:93916853-93916875 ATTGGCTGCGCAGTGACGAGTGG - Intronic
1045041061 8:98225104-98225126 AGCAGATGCACAGTGATGTGAGG - Intronic
1046701535 8:117406208-117406230 CTTTAATGGACAGTGCTGAGCGG - Intergenic
1048025633 8:130584161-130584183 ATTTGATCCACAGTTTTGAAGGG - Intergenic
1050562523 9:6848909-6848931 AGTAGAAGCACAGTGATCAGTGG + Intronic
1051075314 9:13226480-13226502 CTTTGAGGCACAGTGAGGAGGGG - Intronic
1051347049 9:16161569-16161591 ATTTGTTGTAAAGTTATGAGTGG - Intergenic
1052814512 9:33090811-33090833 CTTTGATGGCCAGTGATGATGGG - Intergenic
1056430741 9:86525773-86525795 ATTTGAGCCTCAGAGATGAGCGG + Intergenic
1057297637 9:93858872-93858894 ATATTATGCACAGTGCTGACTGG - Intergenic
1061797192 9:133093062-133093084 AGTTGATGAACAATGATGATTGG + Intergenic
1203613829 Un_KI270749v1:34474-34496 ATATGATACACATTTATGAGAGG + Intergenic
1186585542 X:10869443-10869465 ATTTGATGCTTAGTGAAGGGAGG + Intergenic
1189062965 X:37774004-37774026 CTCTGATGCCCAGTGATGATGGG - Intronic
1190593992 X:52034890-52034912 CTTTGATTCACAGGGATCAGTGG - Intergenic
1191979411 X:66909472-66909494 ATATGATGCAGAGTGGGGAGGGG + Intergenic
1199511813 X:148630781-148630803 ATTTGATGAACAGTCATGAGAGG - Intronic
1199843788 X:151676149-151676171 CTTTCATGACCAGTGATGAGGGG + Exonic