ID: 1008684679

View in Genome Browser
Species Human (GRCh38)
Location 6:53911846-53911868
Sequence CTAGGTGCCCAGAAATATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008684679_1008684683 6 Left 1008684679 6:53911846-53911868 CCATGATATTTCTGGGCACCTAG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1008684683 6:53911875-53911897 TTGTTGATTCCCTTCCTCAAGGG No data
1008684679_1008684682 5 Left 1008684679 6:53911846-53911868 CCATGATATTTCTGGGCACCTAG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1008684682 6:53911874-53911896 ATTGTTGATTCCCTTCCTCAAGG No data
1008684679_1008684685 10 Left 1008684679 6:53911846-53911868 CCATGATATTTCTGGGCACCTAG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1008684685 6:53911879-53911901 TGATTCCCTTCCTCAAGGGAGGG 0: 1
1: 1
2: 0
3: 11
4: 202
1008684679_1008684684 9 Left 1008684679 6:53911846-53911868 CCATGATATTTCTGGGCACCTAG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1008684684 6:53911878-53911900 TTGATTCCCTTCCTCAAGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008684679 Original CRISPR CTAGGTGCCCAGAAATATCA TGG (reversed) Intronic
900859869 1:5221071-5221093 CCAGGGGTCCAGAAATAGCACGG - Intergenic
908714966 1:67060037-67060059 CTAGGTGTCAGGAAATGTCATGG + Intergenic
909249494 1:73333783-73333805 CTAGGTTACCAGAAGAATCAGGG - Intergenic
916370335 1:164086945-164086967 ACAGATGCCCAGAGATATCAGGG - Intergenic
920508852 1:206536078-206536100 CGCAGTGCCCAGAAATACCAGGG - Intronic
922432723 1:225571594-225571616 CCAAGTGGCCGGAAATATCATGG + Intronic
924629056 1:245720168-245720190 CTAGATGACCAGATAAATCATGG - Intergenic
1065422675 10:25564325-25564347 CTAGATTCCCAGAAATATATTGG + Intronic
1066050500 10:31631268-31631290 CTATGTGCCAGGATATATCACGG + Intergenic
1067821502 10:49535021-49535043 CTGGGGCCCAAGAAATATCACGG + Intronic
1068146094 10:53072534-53072556 ATAGGAGCGCAGAAATAGCAAGG - Intergenic
1069930875 10:71880823-71880845 CTAGGTGCCCAGTAAACACATGG - Intergenic
1071155129 10:82678880-82678902 CACGGTGCTCAGAAATATCAAGG - Intronic
1074825897 10:117215798-117215820 TTAGGTGCACAGAAACACCAAGG + Intergenic
1087553135 11:99677495-99677517 ATATGTGCCCCAAAATATCAAGG - Intronic
1092936289 12:13367160-13367182 CTATTTGCCCAGCAAAATCAAGG - Intergenic
1094213979 12:27921341-27921363 CAGGGGGCCCAGAAATAGCAAGG - Intergenic
1100015435 12:90005135-90005157 ACAGGTGCTCAGAAATATCTAGG - Intergenic
1104505180 12:129325271-129325293 TTAGGTGCAAAGAAATACCATGG + Intronic
1106341800 13:28836813-28836835 GTAGGTGCCCTCAAATAACATGG - Intronic
1107067681 13:36232922-36232944 CTAGATTCCAAGAAATATAATGG - Intronic
1109918811 13:69028002-69028024 CAAGATGTCCAGAAATATCATGG + Intergenic
1111771680 13:92604468-92604490 CTAGGTGCCCAGACAGGGCAAGG - Intronic
1114063563 14:19040383-19040405 CTCTGTGCCAAGAAATATCATGG + Intergenic
1114098693 14:19359613-19359635 CTCTGTGCCAAGAAATATCATGG - Intergenic
1119877057 14:78069878-78069900 CTAGGAGCCAAGGAATGTCAAGG + Intergenic
1120283744 14:82471263-82471285 CTATGTGCCCTGAAATAGAATGG + Intergenic
1125780613 15:42263084-42263106 ATATGTTCCCAGAAAAATCAGGG - Intronic
1126212457 15:46115031-46115053 CTATGTGACCAGAAACATAACGG - Intergenic
1128320840 15:66692699-66692721 GTAGGCCCCCTGAAATATCATGG - Intergenic
1128581195 15:68811352-68811374 CTAGGTGCCCAGGAGGAACAAGG + Intronic
1128958043 15:71970808-71970830 CCATGTGGCCATAAATATCAGGG - Intronic
1130214402 15:81954588-81954610 CAAGCTGCCCATAAACATCATGG + Intergenic
1134308431 16:13054447-13054469 CTTGGTTCCTAGAAATATCGGGG - Intronic
1137809692 16:51340981-51341003 CTAGGTGCTCAGAAAAAAAAGGG - Intergenic
1137872020 16:51959383-51959405 CCAGGTGCCCAGCAAAACCAAGG - Intergenic
1144224959 17:13136262-13136284 CCAGGTGCCCAGAACTTTTATGG + Intergenic
1149306432 17:55351279-55351301 CTAGATTCCCAGAAATACCCTGG - Intergenic
1149556921 17:57580024-57580046 CTAGGTACCCAGTAATGTAAAGG - Intronic
1152364818 17:79849529-79849551 CTAGCTGGGCAGAAATATCTGGG + Intergenic
1152478194 17:80532239-80532261 ATGGCTGCCCAGAAATATAAAGG - Intergenic
1153731291 18:8015128-8015150 CTATGTGACTACAAATATCAGGG + Intronic
1156562632 18:38145716-38145738 ATAGGTGGCCAGAAATTGCAGGG - Intergenic
1157934511 18:51858403-51858425 TTGGGTACCCAGAAATATGAAGG + Intergenic
1159479668 18:68972409-68972431 CTAGGTTTCCAGGAATATTAGGG + Intronic
1163041190 19:14603901-14603923 TTTGGTGCCTAGAAATAGCAAGG + Intronic
1167409232 19:49335263-49335285 CTTGGTGCCCACAAATTCCAAGG + Intronic
929350902 2:40953464-40953486 ATAGCTGCACAGCAATATCAAGG + Intergenic
931070845 2:58647871-58647893 CTTGTTGTGCAGAAATATCATGG + Intergenic
931974630 2:67629704-67629726 CTAGGTGCCCAGGAAGAGGAGGG + Intergenic
935486392 2:103660009-103660031 CTAGGTGACAAGAAATAAAAGGG - Intergenic
935942503 2:108255577-108255599 CTATGTGGCCAGAAATCCCAAGG + Exonic
936902920 2:117504249-117504271 AGAGGAGCCCAGAAATATAAAGG - Intergenic
939712854 2:145544698-145544720 CTAGATTCCCAGGAATATAATGG + Intergenic
943260648 2:185657416-185657438 CTAGGTTCCCAGTAAAAACAAGG + Intergenic
944007457 2:194927501-194927523 CTAGCAGCCCAAAAAGATCAAGG - Intergenic
945889549 2:215413911-215413933 CTAGGTGCCCAGAAAATTAGTGG - Intronic
1169432476 20:5550714-5550736 TTATATGTCCAGAAATATCATGG - Intronic
1169879276 20:10328942-10328964 CTTGGGGCCCAGAAAAATCAGGG - Intergenic
1170097293 20:12660372-12660394 CTAGATGCCTTGAAATATCATGG - Intergenic
1170307100 20:14950623-14950645 CTTGGTGCACAGAAACTTCAGGG + Intronic
1170967462 20:21087733-21087755 TTATGTGCCCAGAACTATAATGG + Intergenic
1171031626 20:21681931-21681953 ATAGGTGGCCAGAAATAGAAGGG - Intergenic
1172498265 20:35404949-35404971 CTAGATGCCCAGGAATATATTGG - Intronic
1177873275 21:26599493-26599515 TTCAGTTCCCAGAAATATCATGG - Intergenic
1178223917 21:30692673-30692695 ATAGGTGCCCAGAAGTGTGATGG + Intergenic
1180482057 22:15763017-15763039 CTCTGTGCCAAGAAATATCATGG + Intergenic
1180978823 22:19869047-19869069 CCAGGTGCCCAGGCATGTCAGGG - Intergenic
1180987522 22:19913653-19913675 CTAGGTTCCCAGGAATATGCTGG - Intronic
1182837412 22:33355153-33355175 CATGGTGTCCAGAAATAACAAGG - Intronic
1183345725 22:37306685-37306707 CCAGGTGCCCAGTGACATCACGG + Intronic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
954125716 3:48527045-48527067 CTATGAGCCAAGAAATACCAAGG + Intronic
954611506 3:51946896-51946918 CTAGGGGCCCAGAACGATCGAGG + Intronic
955863425 3:63356359-63356381 CAAGGTGTCCACCAATATCATGG + Intronic
957261612 3:77909276-77909298 CTAGGGGCCAAGGAATGTCAAGG + Intergenic
960918089 3:122717579-122717601 TTAGGTTCCCAGAGATATCTGGG + Intronic
961112093 3:124293057-124293079 CTAGTTTCCCAGATATAACAAGG + Intronic
962255427 3:133867030-133867052 CTAAGGGCACAGAAATTTCATGG + Intronic
964957957 3:162384698-162384720 CTAGGTACCATGAAATATAAAGG + Intergenic
965332568 3:167394784-167394806 TTAAGTGCTCATAAATATCAAGG + Intergenic
967890231 3:194359577-194359599 CTAGTTACCCAGAAACACCATGG - Exonic
970612270 4:17736810-17736832 CCATGTGCCCAGAAAACTCATGG + Intronic
971697210 4:29921744-29921766 TTAAGTGCCCATATATATCATGG - Intergenic
971780596 4:31029372-31029394 CTAGGTGCCCAGACATCTAGAGG + Intronic
978640275 4:110862482-110862504 CTCTGTGCCCAGAAATACCTGGG + Intergenic
983888158 4:173003927-173003949 CAAGGAGCCCACATATATCAGGG - Intronic
984539156 4:181015776-181015798 CTACCTGCCCAGAAATTACAGGG + Intergenic
984921753 4:184770745-184770767 CTATGTGCTCAGAAATAAAATGG - Intronic
993118861 5:83750571-83750593 CTAGATTCCCAGAAATATGTTGG + Intergenic
993730613 5:91417708-91417730 CTAGGTCCCCATAAGTTTCAGGG + Intergenic
994204403 5:97017915-97017937 CTACATGCCCAGGAATACCAAGG - Intronic
995040457 5:107582014-107582036 ATAGGTACCCAGAAAAATCCTGG + Intronic
996804626 5:127440926-127440948 CTAGATGCCAGGAAATATTAAGG + Intronic
997898660 5:137742993-137743015 CTAGGTGCCCAGATGAATCCAGG - Intergenic
999839695 5:155412074-155412096 GTAAGTGGACAGAAATATCAAGG - Intergenic
1000716763 5:164653637-164653659 CTAGGTGCCCAGATTAATAATGG + Intergenic
1002495144 5:179606617-179606639 TTAGATGCCCAGAGACATCAGGG - Intronic
1002639275 5:180623038-180623060 GTAGCTGCCCAGAAAAGTCAAGG + Intronic
1007319583 6:41017863-41017885 CTCTGTGCCCAGAAATTCCAGGG + Intergenic
1007738458 6:43996684-43996706 CTATGAGCCGAGAAATACCAAGG - Intergenic
1008684679 6:53911846-53911868 CTAGGTGCCCAGAAATATCATGG - Intronic
1010795559 6:80113322-80113344 CCAGTTGCCCACAATTATCAGGG + Intronic
1011871676 6:91902112-91902134 CTCTGTGCCCAGATATATAACGG + Intergenic
1013851771 6:114524812-114524834 ATAGGTGCCTAGATAAATCATGG - Intergenic
1017597795 6:156047958-156047980 CTAGGAGTCCAGATATACCAAGG + Intergenic
1020086971 7:5315792-5315814 CTAGGAGCCCTGAGATCTCACGG + Intronic
1022369121 7:29753833-29753855 CAAGGTGCCCATAAGAATCAAGG + Intergenic
1022386468 7:29903973-29903995 CAATGTGCCCAGCAATACCAGGG - Intronic
1022810661 7:33864702-33864724 TAAGGTGCCCAGAAATATCCAGG + Intergenic
1025227610 7:57178415-57178437 CTAGGTCCCCAAAAAGATCTGGG + Intergenic
1025615230 7:63112546-63112568 CCAGGGGCACAGAAACATCATGG - Intergenic
1025730266 7:64101897-64101919 CTAGGTCCCCAAAAAGATCCCGG - Intronic
1027689641 7:81327729-81327751 CTAGATTCCCAGGAATATGATGG + Intergenic
1028254906 7:88583028-88583050 CTAGGAGCCCAGGAAGGTCAAGG - Intergenic
1028829703 7:95313999-95314021 CTAGGTGCACTGCAGTATCAGGG + Intronic
1031957906 7:127960874-127960896 CCAGCTGCCCAGAAACATCCTGG + Intronic
1032451458 7:132035337-132035359 CAAGGTGCTGAGAAATATGATGG - Intergenic
1038261506 8:26000078-26000100 CTAGGACTCCAGAAATATCCTGG - Intronic
1040097504 8:43460257-43460279 CCAGGTGCCCAGCACTATGATGG + Intergenic
1040972395 8:53150835-53150857 CTAGGTACTGAGAAATATCTTGG - Intergenic
1045073648 8:98538940-98538962 CTAATTGCCCAGAAATATGATGG + Intronic
1046951610 8:120024863-120024885 CCATGTGCCCAGAAAAATAATGG + Intronic
1047807327 8:128374062-128374084 CCAGGTACCCTGAAATATTAGGG - Intergenic
1048187541 8:132255473-132255495 CTAGGTTCCCAGGAATATGTAGG - Intronic
1050366208 9:4876090-4876112 TTAGTGGCCCAGAACTATCAAGG - Intronic
1050802061 9:9627845-9627867 CTAGGTGCTGAGAAACAGCAGGG + Intronic
1051668776 9:19489818-19489840 CTATGTGCCCAGAAATGTGCTGG + Intergenic
1052684169 9:31733190-31733212 CTGGGTGCCCAGAAGTATGTTGG + Intergenic
1188103507 X:26120109-26120131 TTAAGTTCCCAGAAATATAATGG - Intergenic
1189208647 X:39263994-39264016 CTAGCAGCCCAGATTTATCAGGG - Intergenic
1197119244 X:122870661-122870683 ATAGGGCCCCAGAAATGTCAGGG + Intergenic
1200738501 Y:6827718-6827740 TTATGTTCCCAGGAATATCATGG + Intergenic
1200743178 Y:6877360-6877382 CCAGGAGCCCGGAAATATCCTGG + Intergenic