ID: 1008685176

View in Genome Browser
Species Human (GRCh38)
Location 6:53918077-53918099
Sequence CTGTGAGCACATGGTGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008685171_1008685176 -2 Left 1008685171 6:53918056-53918078 CCCTCAGGTGTCCTTCTCTAGCT 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1008685176 6:53918077-53918099 CTGTGAGCACATGGTGGCACTGG 0: 1
1: 0
2: 2
3: 19
4: 191
1008685169_1008685176 8 Left 1008685169 6:53918046-53918068 CCCTGAGGTTCCCTCAGGTGTCC 0: 1
1: 0
2: 1
3: 36
4: 393
Right 1008685176 6:53918077-53918099 CTGTGAGCACATGGTGGCACTGG 0: 1
1: 0
2: 2
3: 19
4: 191
1008685172_1008685176 -3 Left 1008685172 6:53918057-53918079 CCTCAGGTGTCCTTCTCTAGCTG 0: 1
1: 0
2: 0
3: 17
4: 187
Right 1008685176 6:53918077-53918099 CTGTGAGCACATGGTGGCACTGG 0: 1
1: 0
2: 2
3: 19
4: 191
1008685170_1008685176 7 Left 1008685170 6:53918047-53918069 CCTGAGGTTCCCTCAGGTGTCCT 0: 1
1: 0
2: 1
3: 13
4: 222
Right 1008685176 6:53918077-53918099 CTGTGAGCACATGGTGGCACTGG 0: 1
1: 0
2: 2
3: 19
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008685176 Original CRISPR CTGTGAGCACATGGTGGCAC TGG Intronic
900116806 1:1032578-1032600 GTGTGACCACGCGGTGGCACTGG + Intronic
900206107 1:1432544-1432566 CTGTGAGAACAGGGGGTCACTGG - Intergenic
900323756 1:2097405-2097427 CTGAGAGCACAGGGGGGCACTGG - Intronic
904321673 1:29701821-29701843 CCGTCAGGACATGGTGGCGCTGG + Intergenic
905996001 1:42380924-42380946 CTGGGAGCACATGGCGGCCAGGG - Exonic
906394896 1:45454023-45454045 CAGTGAGCACATGGAGAAACTGG + Intronic
908289712 1:62652117-62652139 CTGTGCACACATGGTGGAAGAGG + Intronic
909397784 1:75190000-75190022 CTGTGAGCAACTGGAGGCAGGGG - Intergenic
915004232 1:152622136-152622158 CTGTGGGCCCATGGTGACTCCGG - Intergenic
915483016 1:156200040-156200062 CTGCGAGCAGATGGTATCACTGG + Exonic
916747209 1:167693757-167693779 CTGTGAGATCCTGGTGCCACAGG + Intronic
921395518 1:214665199-214665221 CCTTGAGCACATGGGGGCCCTGG - Intergenic
921442985 1:215210958-215210980 GAGTGAGCTCATGGTGGCACAGG - Intronic
922345050 1:224689563-224689585 CTGTGAGCACATGTTGGGGATGG + Intronic
922695864 1:227730756-227730778 CTGGCAGCACAAGGTAGCACAGG - Intronic
923099198 1:230798763-230798785 CTGTGAGCAGATGGGTCCACTGG - Intronic
1062968536 10:1628799-1628821 CCGTGAGCAAATGGCGGGACTGG - Intronic
1062973844 10:1668880-1668902 CTGTGAGCTCCTGGTGGCAAAGG + Intronic
1065883226 10:30055562-30055584 CTGTGAGAACTTGGTGTCCCAGG - Intronic
1068484198 10:57635816-57635838 TTGTGAGCACATGGAGTTACTGG + Intergenic
1071180707 10:82980147-82980169 CTGAGTGCACATGGTGCTACTGG + Intronic
1071429844 10:85598645-85598667 CTGTGAGCAGATGGGTGGACAGG - Intergenic
1073030038 10:100518921-100518943 CTGTGACCAGCAGGTGGCACTGG - Intronic
1073443646 10:103568132-103568154 CTGGGTGCACATGGTGCCCCTGG + Intronic
1074579968 10:114709993-114710015 ATGTGTGCACATGGTGGGAGTGG - Intergenic
1075060427 10:119253182-119253204 ATGTGAGCTCAAGGGGGCACTGG - Intronic
1075969068 10:126637700-126637722 CAGTAGGCACATGGTGGCAGAGG + Intronic
1076218250 10:128712862-128712884 CTGTGGCCACATGGGGGCTCGGG - Intergenic
1076605806 10:131689228-131689250 CTGTGGGCTCCTGGTGGCGCTGG - Intergenic
1077050800 11:565912-565934 CAGTGAGCTCCTGGTGGCCCTGG - Intergenic
1077437320 11:2549235-2549257 CAGTGGGCTCCTGGTGGCACTGG - Intronic
1077613607 11:3660035-3660057 CTCGGAACACCTGGTGGCACCGG - Exonic
1078105584 11:8356312-8356334 CTGTGAGACCCAGGTGGCACTGG + Intergenic
1078169579 11:8919271-8919293 CTGGGGGGCCATGGTGGCACTGG + Intronic
1079134052 11:17766100-17766122 CTGTGAGCACATGGAGGCCCTGG - Intronic
1079444243 11:20545409-20545431 CTGTGAGCACCTGGGCACACTGG + Intergenic
1081879191 11:46433518-46433540 CACAGAGCACATGGTGGCCCAGG - Exonic
1083339593 11:61950426-61950448 CTGTGAGTACAAGGTGCCCCAGG + Exonic
1083826153 11:65205192-65205214 CTGTGAGCAGAAGCTGGCAGGGG + Intronic
1084502242 11:69541628-69541650 GTGTGAGGACCTGGTGCCACTGG + Intergenic
1088397113 11:109381370-109381392 CTCTGAGAAAATGGGGGCACAGG + Intergenic
1088793199 11:113244836-113244858 CTGTCAGCTCACGGTGGCAAGGG + Intronic
1088882080 11:113980317-113980339 CTGTGAGCTCATGGTGGGCAGGG - Intronic
1089215185 11:116830636-116830658 CCGTAAGCACTTGGTGGGACTGG + Exonic
1091828093 12:3530216-3530238 CTCTGATCACATGGTGGGAAAGG + Intronic
1092261889 12:6957324-6957346 CTGTGAGCTCCTCGAGGCACAGG + Intronic
1092306096 12:7302673-7302695 CATTGAGCTCATGGTGGCAGAGG + Intergenic
1094575587 12:31682296-31682318 ATGTGACCACAAGGTGGCAGTGG + Intronic
1094726703 12:33126147-33126169 CTGTTTGGACATGGTGGCATAGG + Intergenic
1096916159 12:55035709-55035731 CTGTGTGCACACGATTGCACTGG - Intergenic
1101787716 12:107900077-107900099 CTGTGAGCACAGGTAGGCAGAGG + Intergenic
1107302049 13:38976271-38976293 ATGTGAGCAAAGGGTGGCTCTGG - Intronic
1107523060 13:41202243-41202265 CTATCTGGACATGGTGGCACAGG + Intergenic
1108322979 13:49304740-49304762 CAGTGAGCAGATGGTGGTGCAGG - Intergenic
1108485257 13:50917158-50917180 CTGTAAGCACAAGGTGGGAGAGG + Intronic
1112209116 13:97356759-97356781 CAGCGAGCACATGATGGCAGTGG - Intronic
1113745671 13:112742422-112742444 GTGTGAGCACGCGGTGTCACAGG + Intronic
1114647686 14:24264584-24264606 GTGTGAGCACATGTGGGCCCAGG + Intergenic
1123013165 14:105358947-105358969 CCGTGAGAATATGATGGCACTGG + Intronic
1125721843 15:41848993-41849015 CTGGGAGCAGATGGTTACACTGG + Intronic
1126795168 15:52254443-52254465 CTGAGAGGAGAAGGTGGCACCGG + Intronic
1126922970 15:53548311-53548333 CTGTAGGAGCATGGTGGCACTGG - Intronic
1128079477 15:64847727-64847749 CTTTGACCACAGGCTGGCACAGG - Intronic
1129671055 15:77607855-77607877 GGGTGAGCACATGGTGGCGGGGG - Intergenic
1129947205 15:79549544-79549566 CTCAGAGCACATGGGGCCACTGG - Intergenic
1132485579 16:188911-188933 CTGTGAGGTGCTGGTGGCACTGG + Intergenic
1132974560 16:2704905-2704927 CCCTCAGCACATGGTGGGACAGG + Intronic
1134049029 16:11123975-11123997 CTCTGAGCACTTGGTGGGTCAGG + Intronic
1136626485 16:31465046-31465068 CTGTGGGCCCATGGAGGGACTGG - Intronic
1138334385 16:56241029-56241051 CTCTGTGTACATGGTGGCCCAGG + Intronic
1138423077 16:56912519-56912541 CTGTGGCCACAGGCTGGCACAGG + Intronic
1140594540 16:76393517-76393539 CTGTGAGCACTTTGGGGCCCAGG - Intronic
1140946324 16:79771315-79771337 CTGTTAGTACATGGTTACACAGG + Intergenic
1142375234 16:89703149-89703171 GTGTGGACCCATGGTGGCACTGG - Intergenic
1144439224 17:15266360-15266382 CTGTGAGCAGATGCTGGCTGTGG - Intergenic
1147653932 17:42077901-42077923 CCCTGGGCACATGGTGGCTCTGG - Intergenic
1148029136 17:44608081-44608103 CAGGGAGCACATGGTGGTCCTGG - Intergenic
1148094692 17:45044239-45044261 CTGTGGGGACATTGGGGCACAGG - Intronic
1152291609 17:79443042-79443064 CTGTGAGGACCTCATGGCACAGG - Intronic
1152457400 17:80424112-80424134 CTGGGACCCCATGTTGGCACTGG + Intronic
1152587353 17:81195022-81195044 CTGTGCCCACAGGGTGGCAAAGG - Intronic
1152643597 17:81459031-81459053 CTGTGGGCACAAGGTGTCAGCGG - Intronic
1153714997 18:7838942-7838964 CTGTGGGCCCATGGTGGCTGTGG - Intronic
1156086038 18:33403872-33403894 CTGTGAGAACAAGGTGGAGCTGG - Intronic
1158038873 18:53069004-53069026 CTGAGACAACATGGTGGCATGGG + Intronic
1158428503 18:57361461-57361483 CTTTGAGAACATTGTAGCACTGG + Exonic
1159888956 18:73936623-73936645 CTGTGTGCACATGGTGACTGAGG + Intergenic
1162017996 19:7856085-7856107 CTGTGAGGACATGGTCGCCATGG + Intronic
1166977340 19:46612374-46612396 CTGTGAGCACCTGCCGCCACTGG + Intergenic
1167665148 19:50819350-50819372 CTGGGAGCACAAGGTGGGAGGGG + Intronic
1168097037 19:54121837-54121859 CTGTGAGGACACGGAGGCATGGG - Intronic
926605354 2:14892384-14892406 CTGTGAGCCCATTGTGCCACAGG - Intergenic
927331869 2:21874564-21874586 CAGTGAGAACATGTGGGCACAGG - Intergenic
928270340 2:29849724-29849746 CTGTCAGCACCTGGTTGCAGTGG + Intronic
928405518 2:31011581-31011603 CTGTGGCCCCAGGGTGGCACTGG - Intronic
929558738 2:42942410-42942432 CAGTGTGCACATGGAGGCAGGGG - Intergenic
933971964 2:87477095-87477117 CAGTGAGCACATGGAGGTAAAGG + Intergenic
934550762 2:95260184-95260206 ATGTGAGCACATGTTGCAACAGG - Intergenic
935688570 2:105709762-105709784 CTGGGTGCACATGAAGGCACAGG - Intergenic
936067507 2:109343571-109343593 CTGTGAGAGCATGGGGGCTCAGG - Intronic
936321762 2:111473102-111473124 CAGTGAGCACATGGAGGTAAAGG - Intergenic
938392138 2:130914927-130914949 CTGTGGGCACATGAGGGCACTGG + Intronic
941677936 2:168363999-168364021 CTGTGAGCACATGGTGACTTTGG - Intergenic
942117827 2:172746332-172746354 CTGTGAGGATGTGGGGGCACGGG + Intronic
942927828 2:181455352-181455374 CTGTAAGCTCATTGTGGAACTGG + Intergenic
946328108 2:218995201-218995223 CTGTGAGCACTTTTTGGCACGGG - Intergenic
1169185495 20:3613303-3613325 CTGAGAACACACGGTGACACGGG - Intronic
1175257207 20:57654728-57654750 CTGTCTGCACATGGAGGCCCTGG - Intronic
1175514304 20:59559255-59559277 CTGCCAGGACATGGTGGCCCAGG - Intergenic
1176370157 21:6057547-6057569 CTGTGAACACAGGGTGCCCCTGG + Intergenic
1177077003 21:16588561-16588583 CTGTGAGCAGGGGGTGGCAGCGG - Intergenic
1177914243 21:27068530-27068552 ATCTGAGCTCATGGTGGCTCAGG + Intergenic
1179373645 21:40829566-40829588 GTGTGAGCACCTGGTGAAACAGG + Intronic
1179623011 21:42631292-42631314 ATGTGATCACATGGTGACGCTGG - Intergenic
1179753362 21:43480994-43481016 CTGTGAACACAGGGTGCCCCTGG - Intergenic
1179827620 21:43975833-43975855 CTGTCCCCACCTGGTGGCACGGG + Intronic
1180082134 21:45491783-45491805 CTGTGAGGCCAGGGTGGCACAGG - Intronic
1180758268 22:18178364-18178386 CTGTGTGCAGATGGAGGCAGTGG - Intergenic
1180768556 22:18362156-18362178 CTGTGTGCAGATGGAGGCAGTGG - Intergenic
1180777754 22:18500235-18500257 CTGTGTGCAGATGGAGGCAGTGG + Intergenic
1180810480 22:18757546-18757568 CTGTGTGCAGATGGAGGCAGTGG + Intergenic
1180826431 22:18865380-18865402 CTGTGTGCAGATGGAGGCAGTGG - Intergenic
1180931565 22:19595860-19595882 CTTTGAGCACAAGATGGCCCAGG + Intergenic
1181105363 22:20571418-20571440 ATGGCAGCACATGGTGCCACAGG - Intronic
1181196624 22:21191801-21191823 CTGTGTGCAGATGGAGGCAGTGG + Intergenic
1181212903 22:21301323-21301345 CTGTGTGCAGATGGAGGCAGTGG - Intergenic
1181582408 22:23835517-23835539 CTTTGAGCACATGTTAGCATGGG + Intronic
1181840110 22:25650151-25650173 CTGGGATTACAGGGTGGCACTGG - Intronic
1182091953 22:27602070-27602092 CTGTGAGCACATGGTTGTTCAGG - Intergenic
1183439688 22:37816177-37816199 CTGTGGGCACAAGGTGTCACAGG - Intronic
1184466485 22:44671399-44671421 TGGGGAGCACGTGGTGGCACGGG + Intronic
1184527765 22:45035636-45035658 CTGTGGGCTGATGGTGGGACCGG + Intergenic
1184585523 22:45445418-45445440 CTGTGAGCCCTAGGGGGCACAGG + Intergenic
1184792687 22:46709517-46709539 CTGTCAGCACCTGGGGGCAGGGG + Intronic
1185287586 22:50009461-50009483 CCGAGAGCACAGGGTGGCACTGG + Intronic
1203230174 22_KI270731v1_random:103044-103066 CTGTGTGCAGATGGAGGCAGTGG - Intergenic
1203276574 22_KI270734v1_random:91286-91308 CTGTGTGCAGATGGAGGCAGTGG - Intergenic
950265026 3:11567187-11567209 CTGTGACCACATGGTTACATGGG - Intronic
950942122 3:16903437-16903459 CTGTGACCACATGGCAGGACAGG - Intronic
954371854 3:50173098-50173120 CTGAGAGGACAAAGTGGCACAGG - Intronic
954600416 3:51863307-51863329 CTGTGACCACACAGTGGCCCTGG - Exonic
955199522 3:56837819-56837841 CTGTGTGCACATGATGGCACAGG - Intronic
963726039 3:148922865-148922887 TGGTGAGCACATGGTGATACTGG + Intergenic
964055175 3:152446668-152446690 CAGCGAGCACATGATGGCAATGG - Intronic
966690165 3:182733381-182733403 CTGTGAAAACATGGTGGCTTAGG - Intergenic
969540261 4:7784303-7784325 ATGTTAGGACAGGGTGGCACGGG - Intronic
970215809 4:13759037-13759059 CTGTGAGGGGATGGTGGTACTGG + Intergenic
975762624 4:77633836-77633858 CTGTGAGAGCATGATGGGACGGG - Intergenic
976461765 4:85320350-85320372 CTGTGGGCACATGGTGGGAGGGG + Intergenic
978408195 4:108401140-108401162 CCGTGAGCACATGGTTGAAGTGG - Intergenic
979474157 4:121135116-121135138 GTGACAGGACATGGTGGCACAGG - Intronic
980495648 4:133585652-133585674 CTATGGGCACATGGTGGGAGGGG - Intergenic
981627595 4:146776810-146776832 CTGTGTGCTCATTGTGGCAGTGG + Intronic
982418696 4:155167776-155167798 CCATGAGCAAATAGTGGCACGGG + Intergenic
984677158 4:182562998-182563020 CTGTGAGTACATGGTGCCTTAGG - Intronic
985667173 5:1187246-1187268 CTGTGAGCAGATGGTGGGGGTGG + Intergenic
986626456 5:9727621-9727643 CTCTGAGCAAAGGGTGGCACTGG + Intergenic
986681340 5:10235581-10235603 CTGTGACCAGCTGGTGGCACCGG + Intronic
992166553 5:74057663-74057685 CTGTGAATACATTGTGACACTGG + Intergenic
993335488 5:86653122-86653144 CTATGAGCAGATGGAGCCACTGG + Intergenic
997040351 5:130245585-130245607 CTGTGAGCAAATGGTTTCACAGG + Intergenic
997470890 5:134116051-134116073 CTGCAAGCACAGGGCGGCACTGG - Intronic
1000313907 5:160070713-160070735 CTTTAGGGACATGGTGGCACTGG + Intronic
1001553251 5:172619405-172619427 CTGTGAGCTCATGCAGGCAGCGG - Intergenic
1001703530 5:173724548-173724570 CAGTGAACACATGGGGACACTGG - Intergenic
1003403482 6:5809801-5809823 CTGTGAGTATTTGGTGGGACTGG + Intergenic
1005204879 6:23391094-23391116 CTGTGAGCTCATGTAGGAACTGG - Intergenic
1005261662 6:24067819-24067841 CTGAGAGCACATGTTTGCAGTGG - Intergenic
1005822211 6:29607321-29607343 CAGGGAGCTCATGGTGGCACAGG + Intronic
1006133028 6:31880009-31880031 CTGCGAGCAGCTGGTGGCAGAGG + Exonic
1006435795 6:34025639-34025661 CTGTTAGCTCATGGGGGCCCTGG - Intronic
1006879541 6:37327118-37327140 CAGGGAGTACATGGTGGCATGGG + Intronic
1007424837 6:41740221-41740243 CTGTGAGCCCATGATGGGGCTGG + Intronic
1007626887 6:43251746-43251768 CTGTGAGAGCGTGGTGGGACCGG - Intronic
1008685176 6:53918077-53918099 CTGTGAGCACATGGTGGCACTGG + Intronic
1008940565 6:57041213-57041235 CTGTGGGCACGTGGTGGTAGTGG + Intergenic
1009027601 6:58018552-58018574 CTGTCAGCTCTTGCTGGCACAGG + Intergenic
1009203137 6:60770029-60770051 CTGTCAGCTCTTGCTGGCACAGG + Intergenic
1010371135 6:75108586-75108608 CTGTGAGCAAATGTGGGCTCTGG + Intronic
1015114972 6:129637768-129637790 CTTTGACCACACGGTAGCACTGG + Intronic
1016600236 6:145850053-145850075 CTCTGAGCACACCATGGCACAGG + Intergenic
1019421311 7:952580-952602 CTGTGGCCACAGGGTGGAACAGG - Intronic
1019524262 7:1473750-1473772 CTGGGAGCAGATGGGAGCACAGG - Intronic
1023614533 7:42006389-42006411 CTGCCAGCACGTGGTGGCCCAGG - Intronic
1025755549 7:64335137-64335159 CTGTCAGCAGATGGGGGCAAGGG + Intronic
1026231420 7:68487440-68487462 CTGTGAGCTCATGGGGGCAGAGG + Intergenic
1029737033 7:102470653-102470675 CTGTGGCCACATGGTGGAGCAGG - Intronic
1033125241 7:138701579-138701601 CTGTGAGCAAATGTTTGCAAGGG - Intergenic
1034241501 7:149614664-149614686 CTAGGCGCACCTGGTGGCACTGG + Intergenic
1034591184 7:152140752-152140774 CCGGGAGCACATGGTGGGAAGGG + Intronic
1035931815 8:3788354-3788376 CTGTGGGCACAGGGAGGCATGGG - Intronic
1037393244 8:18416443-18416465 CTCTGGGCTCATGGTGGCAGTGG + Intergenic
1040129009 8:43772562-43772584 TTGTGAGCCCATGGTGGCTTAGG + Intergenic
1043271337 8:78337786-78337808 CTGTGATCTCCTGGTTGCACAGG - Intergenic
1045114997 8:98972647-98972669 TTGTGAGCACCTGGGGGCAGCGG - Intergenic
1046262044 8:111781212-111781234 CTGTGATCACATGGTGAGAGGGG - Intergenic
1048522609 8:135170898-135170920 CTGTGAGGACAGAGTTGCACAGG - Intergenic
1049432904 8:142573552-142573574 CTATGGGCACTTGGTGGCACTGG + Intergenic
1049472721 8:142783516-142783538 CTGTGACTAAATGGTGGCCCTGG - Intergenic
1049483733 8:142840487-142840509 CTGAGCGCGCATGGTGGCACTGG - Exonic
1050312682 9:4369513-4369535 TTGAGAGAACATGGTGCCACAGG + Intergenic
1052817114 9:33110265-33110287 CTGTGAGCACCTGGTGCAAATGG + Intronic
1053348461 9:37395452-37395474 GTGTGAGCACGTGGGGGCAGAGG + Intergenic
1055565956 9:77568696-77568718 CTGGGTGCACAAGGTGGTACAGG + Intronic
1056405893 9:86274783-86274805 ATGTGAGCATTTGGTGGGACTGG - Intronic
1061674414 9:132207771-132207793 CTGTGGGCACTTGGGGGTACTGG - Intronic
1062120932 9:134833736-134833758 CTGTGAGCAGCTGGAGCCACGGG - Intronic
1062174930 9:135156300-135156322 CTGGGGGGACCTGGTGGCACTGG - Intergenic
1062419582 9:136473509-136473531 CTGTCAGCACGTGGTGGTGCGGG - Intronic
1187996231 X:24929975-24929997 CTGTGAGCCAATCCTGGCACAGG + Intronic
1192233474 X:69281534-69281556 CGGGGAGCACATGCAGGCACTGG + Intergenic
1192593489 X:72382317-72382339 TTGTGACCTCCTGGTGGCACTGG - Intronic
1199188107 X:144939924-144939946 CCGAGAGCACATGGAGGCCCAGG + Intergenic