ID: 1008685519

View in Genome Browser
Species Human (GRCh38)
Location 6:53921975-53921997
Sequence CAGCATGTACATCTTTTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 1, 2: 2, 3: 30, 4: 345}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008685519 Original CRISPR CAGCATGTACATCTTTTAAA TGG (reversed) Intronic
902057039 1:13609767-13609789 CAGCCTGTTCAGCTTTAAAAAGG - Intronic
904561836 1:31403783-31403805 CAGGATGTCCTTCTTTTTAAAGG + Intergenic
904923618 1:34028667-34028689 CAGCATGTACTTCTGTAAGATGG + Intronic
906184327 1:43850216-43850238 CAGCTTGTACATCTCTCAAGGGG + Intronic
908587322 1:65584419-65584441 CTGTATGTACATGTATTAAAGGG + Intronic
909462781 1:75937971-75937993 CAGGATTTACTTCTTTTATAAGG + Intergenic
909856918 1:80546435-80546457 CAGAATGTATCTCTTTTAGAAGG + Intergenic
910041580 1:82858320-82858342 CACCATGTAGATCTTTTTGATGG - Intergenic
910260134 1:85285954-85285976 CAGCAAATACCTCCTTTAAATGG - Intergenic
910566775 1:88652560-88652582 CAGGATTTCCTTCTTTTAAAAGG - Intergenic
910653058 1:89590707-89590729 CAGCAAGTACCTCGTTTAACTGG - Intronic
911522741 1:98948011-98948033 CATCATGTACTTCTTTTCACTGG - Intronic
911692895 1:100855507-100855529 CAGCCTGTACATCTAAAAAAGGG - Intergenic
911750422 1:101490440-101490462 AAGAATGAACATCTTTAAAATGG - Intergenic
911790357 1:102007324-102007346 TATCCTATACATCTTTTAAAAGG - Intergenic
912169053 1:107075459-107075481 CAACAAGTACTTCTTTGAAAAGG + Intergenic
913344103 1:117790785-117790807 CAGAATTTCCATCTTTTTAAAGG + Intergenic
916839292 1:168583590-168583612 GAGCATGTACTTCGTTTTAAAGG + Intergenic
916984951 1:170181156-170181178 CAGATTATACATCTTTTAATAGG + Intergenic
917243342 1:172973417-172973439 CAGCAGGTACAAATTTAAAAAGG - Intergenic
917446803 1:175112923-175112945 CAGCAAGTCTATCTTTTAAGTGG + Intronic
917661707 1:177182795-177182817 CAGGATGCACATCTGTGAAATGG + Intronic
918791460 1:188835975-188835997 ATGCATGTACATATATTAAAGGG - Intergenic
919017931 1:192064733-192064755 CAGAATTTATTTCTTTTAAAAGG - Intergenic
920775916 1:208936986-208937008 CAGCATGCCCAGCTCTTAAAAGG - Intergenic
920884129 1:209910145-209910167 CAACCTGTACATTTTATAAAAGG - Intergenic
920893743 1:210022197-210022219 CAGCATGTACAGTTGTCAAAGGG + Intronic
921645363 1:217609274-217609296 CTGCTTGTACATCTTTAGAATGG - Intronic
922961604 1:229651587-229651609 GAGCATGTATATCATGTAAAGGG + Intronic
923118994 1:230972745-230972767 CAGTATGTAGATCTTTTAAAAGG + Intronic
923635230 1:235689312-235689334 CAGGATTTCCATCTTTTTAAAGG - Intronic
923868643 1:237966692-237966714 CAGTATGTACATATATTATATGG + Intergenic
924481252 1:244436378-244436400 CAGCATTTACTTCATTTAGAAGG + Intronic
1063720088 10:8571178-8571200 CAACTTGTTCATCTTTGAAACGG - Intergenic
1064339695 10:14474947-14474969 CAGCATACACATTTTTTGAAAGG - Intergenic
1064693418 10:17941029-17941051 AATCATGGACATCTTTTAAAAGG + Intergenic
1066186618 10:33015728-33015750 CAGCAATTGAATCTTTTAAAAGG - Intergenic
1066324960 10:34349914-34349936 CTGCATGTACTCCTTTTTAATGG - Intronic
1068762344 10:60726529-60726551 CAGCTTCCACATCTTTAAAATGG - Intronic
1068944541 10:62716324-62716346 CAGCATTTTCTTCTTTTGAAAGG - Intergenic
1068983107 10:63082182-63082204 AAGAATGCACATTTTTTAAAGGG - Intergenic
1069447177 10:68484198-68484220 CTGGATATACATCCTTTAAAAGG - Intronic
1070620050 10:78002475-78002497 GAACATGTACATCTTCTACAAGG + Intronic
1071756144 10:88542418-88542440 CAACGTGTACATCTTCTAGATGG + Intronic
1071776353 10:88792606-88792628 TACCATTTACTTCTTTTAAAGGG + Intergenic
1071797268 10:89020178-89020200 CATCATGTACATGTCTGAAAAGG - Intergenic
1072439847 10:95444611-95444633 CAGCATATCCATCATTTTAATGG + Intronic
1073865345 10:107797106-107797128 AAACATGTTCACCTTTTAAATGG + Intergenic
1075325668 10:121530271-121530293 CAACAGACACATCTTTTAAAAGG + Intronic
1075444384 10:122503649-122503671 CAGTATCCACATCTTTAAAATGG + Intronic
1075577230 10:123586136-123586158 CACCATGTGCTTCTTTTGAATGG - Intergenic
1075705862 10:124500173-124500195 CAGCCAGTAAATTTTTTAAAAGG - Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1079085926 11:17444832-17444854 CAGCTTCTCCATCTTTAAAATGG + Intronic
1079851586 11:25542474-25542496 CAGGATCTACACATTTTAAATGG - Intergenic
1080334374 11:31179491-31179513 CAGCATTTCCTTCTTTTTAAAGG - Intronic
1081536627 11:44001575-44001597 CGGCGTGTCCATCTGTTAAATGG + Intergenic
1081635338 11:44717771-44717793 CAGCTTCTCCATCTGTTAAATGG - Intergenic
1081901104 11:46628736-46628758 CAACAAGTACATTTTTAAAAAGG - Intronic
1082012364 11:47458766-47458788 CAGATTGTTCATCTGTTAAATGG - Intergenic
1083085626 11:60141346-60141368 CAGTATTTATATTTTTTAAAAGG + Intergenic
1084634671 11:70383589-70383611 CAGCATGAACAGATTTAAAATGG + Exonic
1085064772 11:73484256-73484278 CAGCTTATACATCCTTAAAACGG - Intronic
1085827303 11:79861215-79861237 CAACATCCACATCTTCTAAATGG - Intergenic
1087512491 11:99115313-99115335 TATCTTGTACATCTTTTAGAAGG + Intronic
1087704592 11:101475800-101475822 CAGGATTTTCTTCTTTTAAAAGG + Intronic
1087885473 11:103476885-103476907 CAGCTACTACATCTCTTAAATGG - Intronic
1087932335 11:103992489-103992511 TTGCTTTTACATCTTTTAAATGG - Intronic
1088605015 11:111521054-111521076 CAGCATGAATTTCATTTAAAGGG - Intronic
1088766416 11:112984228-112984250 CAGGATGTCCCTCTTTTTAAAGG + Intronic
1088984419 11:114892937-114892959 CAGCTTCTCCATCTTTAAAATGG - Intergenic
1089908246 11:122068011-122068033 GAGCATGAACATCATTAAAAAGG - Intergenic
1090754694 11:129779547-129779569 CACCATGTACATGTCTGAAAAGG + Intergenic
1092481799 12:8865975-8865997 AAGAATGAACATCTTTTAATAGG + Intronic
1093846138 12:23973458-23973480 CAGAATTTCCATCTTTTTAAAGG + Intergenic
1095189553 12:39240873-39240895 CAGCAAATACCTCGTTTAAATGG - Intergenic
1095797385 12:46234830-46234852 AAGCAAGTGCATCTTTTAAATGG - Intronic
1098518568 12:71408441-71408463 CAGGATTTCCTTCTTTTAAAAGG - Intronic
1099705310 12:86145089-86145111 CAGGGTATACAACTTTTAAATGG + Intronic
1100097791 12:91064811-91064833 CAGCAAGTACATGATATAAATGG - Intergenic
1100929843 12:99594537-99594559 CAGGATTTACTTCTTTTTAAAGG - Intronic
1101111328 12:101489419-101489441 CAGAATGTCCTTCTTTTTAAAGG - Intergenic
1101584314 12:106071221-106071243 CAGTATTCTCATCTTTTAAATGG - Intronic
1102408577 12:112696443-112696465 CCACTTGTACATCTGTTAAAAGG - Intronic
1102693982 12:114783672-114783694 CAGAACATACATATTTTAAAGGG + Intergenic
1104232029 12:126894657-126894679 AAACATGGACATCTTCTAAAAGG - Intergenic
1105727282 13:23177039-23177061 CAGGATTTCCTTCTTTTAAAAGG - Intergenic
1106671303 13:31908303-31908325 CAGCAGGAAAATCTGTTAAATGG + Intergenic
1106679576 13:31996434-31996456 CAGGAAGTATATGTTTTAAAAGG - Intergenic
1107624479 13:42269252-42269274 TAGCAAATACATTTTTTAAAAGG - Intergenic
1109142445 13:58731355-58731377 TAATATGTACATCTTTTAAGTGG - Intergenic
1109683012 13:65777314-65777336 CAACATGTACATATTTTAAGAGG + Intergenic
1112480639 13:99772059-99772081 CTGCCAATACATCTTTTAAAGGG - Intronic
1113492521 13:110703642-110703664 ATGCATGTCAATCTTTTAAATGG + Intronic
1113925210 13:113938106-113938128 CTGCATGTTCATCTTGTGAAAGG - Intergenic
1114748709 14:25179670-25179692 CAGAATTTCCTTCTTTTAAAAGG - Intergenic
1117290621 14:54329037-54329059 ATGCATGGACGTCTTTTAAAGGG - Intergenic
1118492792 14:66277876-66277898 CATGATTTCCATCTTTTAAATGG - Intergenic
1118800563 14:69185831-69185853 CAGCCTGTACTTCTTTTACATGG - Intergenic
1119373653 14:74169700-74169722 CAACATGAACAAGTTTTAAAAGG - Intronic
1119646861 14:76354486-76354508 CAGCCTTTACATCTGTAAAATGG - Intronic
1120461353 14:84800709-84800731 CAGTATGTACATCTTTAAAGAGG + Intergenic
1121387372 14:93540427-93540449 CAGTTTGTTCATCTTTGAAATGG + Intronic
1123927688 15:25134376-25134398 CACCATGTACATATCTGAAAAGG + Intergenic
1124010823 15:25837337-25837359 CAGGATTTCCTTCTTTTAAAAGG - Intronic
1125178575 15:36854859-36854881 CAGAATTTACTTCTTTTTAAAGG - Intergenic
1126076432 15:44915153-44915175 CCGCATTTTAATCTTTTAAAAGG - Intergenic
1127579685 15:60326949-60326971 CAGCATGTAAATGTTTGAAAAGG + Intergenic
1128814209 15:70594595-70594617 CAGCAAAAATATCTTTTAAATGG - Intergenic
1128916656 15:71568981-71569003 CAGCATGTATTACTTTAAAATGG + Intronic
1128968367 15:72084675-72084697 CAGCAATTACATGTTTGAAAAGG + Intronic
1130860059 15:87877809-87877831 CAGCATGTCCATCTGTAAGATGG + Intronic
1131778449 15:95827816-95827838 CAGCATTTGCTTCTCTTAAATGG + Intergenic
1134206847 16:12245266-12245288 CAGTATTTTCATCTGTTAAATGG + Intronic
1137294842 16:47081675-47081697 AAGAATTTACCTCTTTTAAATGG + Exonic
1138069212 16:53973913-53973935 GAGCATATACCTCATTTAAAAGG + Intronic
1138863638 16:60790519-60790541 CAGCTTTCACATCTTTAAAATGG - Intergenic
1138864714 16:60802861-60802883 CAGTAAGTACAATTTTTAAACGG - Intergenic
1139319247 16:66100071-66100093 CAGGATTTCCCTCTTTTAAAAGG - Intergenic
1139331133 16:66191218-66191240 CAGGATTTACTTCTTTTTAATGG - Intergenic
1140142936 16:72276303-72276325 GAGCCTCTACATCTTTTGAAAGG - Intergenic
1141611520 16:85183746-85183768 CAGCCTGTACATCTGTAAAATGG - Intronic
1147450063 17:40498875-40498897 CAGCATCTTCATCTGTAAAATGG - Intronic
1147556810 17:41484885-41484907 CAGCAGGTTCATCTGTGAAATGG - Intergenic
1150076095 17:62193216-62193238 CAGCATATATTTCTTTTTAAAGG + Intergenic
1150918113 17:69456881-69456903 CAGCAGGGACAACTTTAAAACGG - Intronic
1152943744 17:83186892-83186914 CAGCATCTTCATCCATTAAAGGG - Intergenic
1153507132 18:5812486-5812508 CAGCAAGAACAGCATTTAAATGG + Intergenic
1154013637 18:10596903-10596925 CAGCATGTACATCCTATGCAGGG + Intergenic
1156020766 18:32597344-32597366 CAGCAAGTGCTTCTTTCAAAGGG - Intergenic
1156172826 18:34506642-34506664 CATCAGGCACAACTTTTAAAAGG - Intronic
1157397951 18:47358891-47358913 CAGAATTTATTTCTTTTAAAAGG + Intergenic
1157970440 18:52261307-52261329 TAGAATTTACATCTTTGAAATGG + Intergenic
1158481715 18:57827623-57827645 CATTATTTACATCTTTAAAAAGG + Intergenic
1158578297 18:58658789-58658811 CAGAATTTACATTTTTCAAAAGG + Intergenic
1158772129 18:60531920-60531942 CAGCTTTTACATCTTTAAAATGG - Intergenic
1159155813 18:64580064-64580086 CAGCATTTACTTATTTAAAAAGG - Intergenic
1159986620 18:74849399-74849421 CAGCTTTTTCATCTCTTAAAAGG + Intronic
1161784852 19:6318022-6318044 CAGCCTGAACATGTTTTAAATGG - Intronic
1163740804 19:19010658-19010680 CAGAATTGACACCTTTTAAATGG + Intronic
1164858130 19:31540978-31541000 CAGAATGGCCATGTTTTAAAAGG - Intergenic
1168375417 19:55873923-55873945 GTGCATGTATATATTTTAAAAGG + Intronic
1168495802 19:56848966-56848988 CAGCATTTCCTTCTTTTTAAAGG + Intergenic
925125214 2:1449819-1449841 AAGCATTTGCATCTTTTGAAGGG + Intronic
925866310 2:8230176-8230198 CAGCAAGTCCATTTTTTAAAGGG + Intergenic
927330542 2:21857866-21857888 CAAACTGTACATCTATTAAAGGG - Intergenic
928227574 2:29465847-29465869 AAGCATTCAAATCTTTTAAAGGG - Intronic
929644869 2:43616348-43616370 AAGAATGTACGTATTTTAAAAGG - Intergenic
930586158 2:53269245-53269267 CAGCATTTACTTCTTTGAAAAGG - Intergenic
930767280 2:55096961-55096983 GGGCATGTACAAATTTTAAAGGG + Intronic
931647236 2:64435608-64435630 CAGCATTTACATATGTTAGAAGG + Intergenic
935205757 2:100895494-100895516 CAGCATCCACATCTGTGAAAGGG - Intronic
935234874 2:101130003-101130025 CAGCTTGTTCATCTGTAAAAAGG + Intronic
936733988 2:115418096-115418118 CAGAATGTAAATCATTTCAAAGG + Intronic
937058610 2:118963541-118963563 CAGAATGTACATCCTTTTCAAGG - Intronic
937539934 2:122936870-122936892 CAGCTTTGACATCTTTAAAATGG + Intergenic
937739180 2:125329469-125329491 CAGCATGTTCATCTTTTAAATGG - Intergenic
938583135 2:132666021-132666043 CAGCATGTAATTCTATTACATGG - Intronic
939081889 2:137672597-137672619 CAGCATCTAATTCTATTAAATGG + Intronic
940020399 2:149150355-149150377 CTTCATGTGCATCTTTTAATAGG + Intronic
940438140 2:153679482-153679504 ATGCATGTACATTTTTTAGATGG - Intergenic
940750921 2:157626558-157626580 CAGCAAGTACATGTCATAAATGG + Intronic
941469537 2:165867555-165867577 CAGCACATACATTTTATAAAAGG + Intronic
941487095 2:166095831-166095853 CAGCATGAAAAACTATTAAATGG + Intronic
941591085 2:167421592-167421614 AAGCATTCACATCTTTAAAAGGG + Intergenic
943029128 2:182666239-182666261 AAGCATGTACATTTTTTGAGGGG - Intergenic
943529466 2:189061155-189061177 CAGTATGTACATTATTTAATAGG - Intronic
943641859 2:190368284-190368306 TGGCATGTACATCTCTTAAGGGG + Intronic
944500347 2:200352987-200353009 CAGCATCTACATGTTGTACATGG + Intronic
945036139 2:205705695-205705717 CAGTATCTACATCTGTTAAATGG - Intronic
945187262 2:207151847-207151869 CAGCAAGTAATTTTTTTAAATGG + Intronic
945308983 2:208288244-208288266 CAGCATCCACATCTGTCAAAAGG - Intronic
945541649 2:211094939-211094961 CCACATTTACATATTTTAAATGG - Intergenic
947018322 2:225646248-225646270 CAGCAGGAATATTTTTTAAATGG - Intronic
947158752 2:227190365-227190387 ATGCATGTCCATATTTTAAAAGG - Intronic
947302201 2:228700497-228700519 CTGAATGTACATCTATTACAAGG + Intergenic
948314833 2:237019747-237019769 CAGTTTGCACATCTTTAAAATGG - Intergenic
948399841 2:237675664-237675686 GAGCAGGTACTACTTTTAAAGGG - Intronic
1170549123 20:17460931-17460953 TAGCCTTTACATCTTTAAAATGG - Intronic
1173128272 20:40360849-40360871 GAGCGTGTTCATTTTTTAAATGG - Intergenic
1173237590 20:41261720-41261742 CAGCATGTACAGAAATTAAAAGG - Intronic
1173390848 20:42631462-42631484 TAGCATGTAGATGTTTTAAGTGG + Intronic
1173491436 20:43486006-43486028 CAGCATGGATATCTCTGAAAAGG + Intergenic
1173798210 20:45877523-45877545 CAGCAAATCCATCCTTTAAAAGG + Exonic
1175282925 20:57816518-57816540 CATCATTTGCATCCTTTAAAAGG - Intergenic
1177154650 21:17489316-17489338 CATCAAGAACATCTGTTAAATGG - Intergenic
1178146772 21:29749422-29749444 CAGCATCTCCATCTGTGAAATGG + Intronic
1181952188 22:26562552-26562574 CAGCAGTTACATCTTAGAAAAGG - Intronic
1183664396 22:39239047-39239069 CGGCTTCTGCATCTTTTAAATGG + Intronic
950738340 3:15029603-15029625 CAGCATTCACATCTGTAAAATGG + Intronic
951242117 3:20298890-20298912 CAGGATTTTCATCTTTTTAAAGG + Intergenic
951478673 3:23135854-23135876 CTGCATGATCCTCTTTTAAAGGG + Intergenic
952074282 3:29676755-29676777 CATCATGTATATTTTTTAAAAGG - Intronic
954491340 3:50909425-50909447 CAGCATTTGCTTCTTTGAAAAGG + Intronic
955139699 3:56257032-56257054 CAGCTTCCATATCTTTTAAATGG + Intronic
955473144 3:59307826-59307848 CAGCATTTAAATTTTCTAAAAGG + Intergenic
956087882 3:65632709-65632731 CTTCATGTACATCTTGTCAATGG - Intronic
956113074 3:65890688-65890710 CAACTTGTACCTCTTATAAATGG - Intronic
956128891 3:66036946-66036968 CAGCAAATGCATCTTTTAAAAGG + Intronic
956633693 3:71342074-71342096 CAGCATGTAAATCTGATAAGCGG - Intronic
956838366 3:73114446-73114468 CTTTATTTACATCTTTTAAATGG + Intergenic
956924577 3:73970286-73970308 AAGCATCCAAATCTTTTAAAAGG - Intergenic
957343544 3:78931653-78931675 CAGCAAGTATAGATTTTAAAAGG + Intronic
957514112 3:81229401-81229423 GAGCATTTAAATCATTTAAAAGG + Intergenic
957754363 3:84467470-84467492 CAGCATCTGCATCTTTGAAGAGG + Intergenic
958443247 3:94181925-94181947 CAATATTTACATCTTTTATAGGG - Intergenic
958759421 3:98290171-98290193 CAGCATTTTCTTCTTTGAAAAGG + Intergenic
960260816 3:115566199-115566221 CAGCATTTCTATCTTTAAAATGG + Intergenic
960892304 3:122462254-122462276 CAGCATCTAAGTTTTTTAAATGG + Intronic
962281515 3:134055565-134055587 CACCATGACCATCTTTGAAAGGG - Intergenic
963211901 3:142701965-142701987 CAGCATATATTTCTTTTAAGCGG + Intronic
963794133 3:149614657-149614679 CAATATGAACATCTTTCAAAAGG + Intronic
966894669 3:184434880-184434902 CAGAATGTCCTTCTTTTTAAAGG + Intronic
967116337 3:186342876-186342898 CTGCAGGCACATTTTTTAAAAGG - Intronic
967466933 3:189817916-189817938 AAGTATTTACATTTTTTAAATGG - Intronic
967670347 3:192226383-192226405 CAGCATGTTCATGTTTCAAATGG - Intronic
967731597 3:192912106-192912128 AAGCATTTACATCTTTGAAATGG + Intronic
968111506 3:196051723-196051745 CATCATGGACATTTTTTAAGTGG + Exonic
968886162 4:3334057-3334079 AAGCATTTACAATTTTTAAAAGG - Intronic
970530864 4:16982008-16982030 TAGCAAAAACATCTTTTAAAAGG + Intergenic
970623686 4:17853523-17853545 CACCAAGTTCATCTTTTCAAAGG + Intronic
970699678 4:18720872-18720894 CAGCAATTACTTTTTTTAAAAGG + Intergenic
971082546 4:23231056-23231078 CACCATTTATATCTTTTAATGGG - Intergenic
971179923 4:24320148-24320170 CAGCAAGTACAGATTTTCAAAGG - Intergenic
972069689 4:35001695-35001717 CAGAATGTACCTCTTATAAAAGG - Intergenic
973218966 4:47704046-47704068 CAGCGTGTAAATCATTTAACAGG - Intronic
975657895 4:76659937-76659959 CAGCATATGCATGTTTTAGATGG - Intronic
975758714 4:77596977-77596999 CAGCATTTTCATCTTTTTAAAGG - Intronic
977139142 4:93344947-93344969 CAGCATTTCCTTCTTTTTAAAGG + Intronic
977383922 4:96313432-96313454 CATCATTTATATATTTTAAAAGG + Intergenic
977418784 4:96769108-96769130 AAGGATGTACATTTTTTTAATGG + Intergenic
978960915 4:114677342-114677364 CAACATTTAATTCTTTTAAATGG + Exonic
979105349 4:116679618-116679640 GAGCATGTGAATATTTTAAATGG + Intergenic
979190589 4:117851948-117851970 CAGCCAGTATATCTTTTAAGTGG - Intergenic
981229975 4:142341258-142341280 CAACATGCACATATTTTAAGGGG + Intronic
981852903 4:149252155-149252177 CAGCAAGTATATTCTTTAAAAGG + Intergenic
982979675 4:162116695-162116717 CAGCCTCTAACTCTTTTAAAAGG - Intronic
983105451 4:163681131-163681153 CAGTATCTCCATATTTTAAAGGG + Intronic
984045660 4:174795077-174795099 CAACATGTTGATCTTTAAAAAGG - Intronic
984319025 4:178167506-178167528 ATGCATGTACATCTGTTAGATGG + Intergenic
985987119 5:3525143-3525165 CAGGATGTCCTTCTTTTTAAAGG - Intergenic
986787102 5:11124636-11124658 CAGGTTTTACATTTTTTAAAAGG - Intronic
987559475 5:19500744-19500766 AAGCATGTACATATTTTTTAGGG + Intronic
988288984 5:29260215-29260237 ATGCATGTAAATGTTTTAAATGG - Intergenic
991679224 5:69122090-69122112 CAGAATGTCCCTCTTTTTAAAGG - Intronic
993276719 5:85869054-85869076 CTCCATTTACATATTTTAAAGGG - Intergenic
993440498 5:87951053-87951075 CAGCATGTAGGTCTTTCAGAAGG - Intergenic
993540529 5:89144951-89144973 CAGTATGTCCTTCTTTTTAAAGG + Intergenic
993844600 5:92924983-92925005 CTGCATGTACATCTTTACAAAGG - Intergenic
994223644 5:97226356-97226378 CAGCATGTCAATCTTTTAAAAGG - Intergenic
995301729 5:110592793-110592815 CAGCATTTCAATCTTTAAAATGG - Intronic
996086769 5:119312899-119312921 TAGAATGTACATTTTTAAAAGGG + Intronic
996619528 5:125483238-125483260 CAGTAGGTACATGTTGTAAAAGG + Intergenic
996952591 5:129145814-129145836 CAGCATTTCCTTCTTTTTAAAGG + Intergenic
997293434 5:132754276-132754298 CAGCATCTCCATCTGTAAAATGG - Intronic
997395251 5:133554449-133554471 CAGCATTTACATTTCTGAAATGG + Intronic
997741489 5:136258775-136258797 AAGTATGTACATTCTTTAAATGG + Intronic
998156827 5:139791897-139791919 CAGCATGGACAACTTTTTCAAGG + Intergenic
998809924 5:145956068-145956090 CAGAATGTACATTTTTAACAGGG - Intronic
999075046 5:148787587-148787609 AAGCATGTACTTTCTTTAAAAGG + Intergenic
1000944423 5:167402944-167402966 AAGCATATACTTCTTTTATAAGG - Intronic
1000986840 5:167869736-167869758 CTGCATGTGCAGCTTTTAGAGGG - Intronic
1001849800 5:174953479-174953501 CCGCATGTGTATATTTTAAAAGG + Intergenic
1001871712 5:175161825-175161847 CAGTTTCTACATCTGTTAAATGG + Intergenic
1003410825 6:5861466-5861488 CAGAATGTCCTTCTTTTTAAAGG - Intergenic
1003530647 6:6934810-6934832 CTTCATATACATGTTTTAAAAGG + Intergenic
1004091279 6:12504417-12504439 CAGCATTCTCATCTGTTAAATGG - Intergenic
1004717805 6:18234986-18235008 CTTCATGTAAATTTTTTAAAGGG - Intronic
1006927168 6:37663410-37663432 CAGCATGTCCATCTTTGAGTTGG - Intronic
1006973235 6:38068970-38068992 TAGCAAGGACATCTGTTAAAAGG - Intronic
1007825567 6:44597915-44597937 CAGCATATCCATATTATAAAAGG - Intergenic
1008235334 6:49039823-49039845 CAGAATTTACATCTTTTATAAGG + Intergenic
1008685519 6:53921975-53921997 CAGCATGTACATCTTTTAAATGG - Intronic
1010363378 6:75021121-75021143 TACCATGTAGATCTTTGAAAAGG - Intergenic
1010739669 6:79485549-79485571 CAGGTGGTACATCTTTTAATTGG + Exonic
1011205089 6:84884188-84884210 GTGCATGTAAATCTTTTAAGAGG - Intergenic
1011207656 6:84917600-84917622 AAGCTTGTTTATCTTTTAAATGG - Intergenic
1012456868 6:99417215-99417237 CATCATTTTCATCATTTAAATGG - Intronic
1012858716 6:104533423-104533445 CTGCATTTACATCCTCTAAAGGG + Intergenic
1013618188 6:111864367-111864389 CAGTTTTTCCATCTTTTAAATGG + Intronic
1014425839 6:121304961-121304983 CAGAATGTACTTATTTAAAAAGG + Intronic
1015302931 6:131674845-131674867 CAGGTTGTAATTCTTTTAAAGGG + Intronic
1016235688 6:141862654-141862676 CAGAATTTACTTCTTTTAAAAGG - Intergenic
1016478654 6:144457137-144457159 CACAATTTACATCTTATAAAAGG - Intronic
1017912504 6:158806135-158806157 CTCCATGCACATGTTTTAAAAGG - Intronic
1020482963 7:8684835-8684857 CAGCAAGTACATCTTATAGAAGG - Intronic
1020723962 7:11785472-11785494 CAGCATTTCCATTTTGTAAAGGG + Intronic
1021982917 7:26072134-26072156 CATCATATAAATCTTTAAAATGG - Intergenic
1022446659 7:30476629-30476651 CCACATATATATCTTTTAAATGG - Intronic
1023087523 7:36586247-36586269 GAGCATGTACAACTTTTAATGGG - Intronic
1023236549 7:38095925-38095947 CAGGATTTACTTCTTTTTAAAGG - Intergenic
1023486544 7:40693466-40693488 CAGCTTCTTCATCTGTTAAATGG - Intronic
1023942779 7:44780782-44780804 CAGCCCCTACATCTTTTAAAAGG + Intergenic
1024641248 7:51330431-51330453 CAGCATGATCCTCTTCTAAAGGG - Intergenic
1026113038 7:67473550-67473572 CTCCAAGTGCATCTTTTAAATGG + Intergenic
1026394394 7:69936810-69936832 TTGCATTTAGATCTTTTAAATGG - Intronic
1026951941 7:74353558-74353580 CAGCATCTTCATCTGTAAAAGGG - Intronic
1027573659 7:79904225-79904247 CAGAATTTCCATCTTTTTAAAGG - Intergenic
1027723786 7:81777055-81777077 CAACATGTACATATAGTAAAAGG - Intergenic
1027876025 7:83769762-83769784 TAACATGCACATTTTTTAAAAGG - Intergenic
1028409495 7:90513113-90513135 AACCATGTACAGCTTTTCAAGGG + Intronic
1030183312 7:106733242-106733264 CAGGATTTCCTTCTTTTAAAAGG - Intergenic
1030355077 7:108532597-108532619 CAGAATGTCTATTTTTTAAAAGG + Intronic
1031019996 7:116617184-116617206 CATCAAATATATCTTTTAAATGG - Intergenic
1031466777 7:122122846-122122868 CAGTATGTTCACGTTTTAAATGG - Intronic
1031745637 7:125494375-125494397 CAGAATTTTCTTCTTTTAAAAGG - Intergenic
1032503896 7:132421266-132421288 CAGAATGTCCTTCTTTTTAAAGG + Intronic
1033293526 7:140109407-140109429 CAGCATTTCCTTCTTTTATAAGG + Intronic
1033685845 7:143640652-143640674 CAGAATGCTCATCTATTAAAGGG - Intronic
1034123047 7:148644661-148644683 CACCACATACATCTTATAAATGG - Intergenic
1034249701 7:149678580-149678602 CAGAATTTCCATCTTTTTAAAGG + Intergenic
1034305945 7:150045622-150045644 TAACATGTACATTTTTTAATGGG - Intergenic
1035082610 7:156230243-156230265 AAGCATGTACTTCATTGAAAAGG + Intergenic
1035953313 8:4048477-4048499 CAGTTTGTTCATCTTTAAAATGG - Intronic
1037846267 8:22285396-22285418 CAGGATGTACTTCTTTTTAAAGG + Intronic
1038389168 8:27179254-27179276 CAGCATGTACAGAGATTAAAGGG - Intergenic
1038883754 8:31640590-31640612 CAGCAGGTACATCTTCTTCATGG + Intronic
1040278491 8:46025873-46025895 CAGCATGTCCAGCTTTAAAGGGG - Intergenic
1041150505 8:54927611-54927633 CATACTGTATATCTTTTAAATGG - Intergenic
1041405718 8:57497096-57497118 CCCCATGTACATCTTTTTATTGG + Intergenic
1042306368 8:67337511-67337533 CAGCATGTTTATGTTTTTAAAGG - Intronic
1042385838 8:68173271-68173293 CAGCATCTGCACCTTTCAAATGG - Intronic
1042881462 8:73496486-73496508 AAACATGTACAACTTATAAATGG - Intronic
1043324768 8:79035848-79035870 CAGCATTTACATGTCTGAAAAGG - Intergenic
1043977103 8:86595955-86595977 CAGCATTTAAATGTTTTGAATGG + Intronic
1044172958 8:89079707-89079729 CAACATGTACTTCTTGTGAAAGG - Intergenic
1045545553 8:103125126-103125148 CAGCAGGCACATCTATTCAAAGG - Intergenic
1045883351 8:107066426-107066448 CAGAATTTCCCTCTTTTAAAAGG - Intergenic
1046248691 8:111601314-111601336 CATCAAGGACATCTTTAAAAAGG + Intergenic
1046338698 8:112824516-112824538 CAGCATTTTCTTCTTTTGAAAGG + Intronic
1047563065 8:126009933-126009955 CAGAACGTACACCTTTAAAATGG + Intergenic
1047863668 8:128996982-128997004 CATCATGTTCATCTGTTTAAAGG + Intergenic
1048202070 8:132382903-132382925 CAGCATTTCCATCTGTAAAATGG + Intronic
1048544628 8:135375144-135375166 CAACATGAACAGCTTCTAAAAGG + Intergenic
1049368211 8:142251087-142251109 CAGCATTTTCGTCTTTTAAATGG - Intronic
1049408283 8:142461265-142461287 CAGCATGCCCATCTGTCAAATGG + Intronic
1050469418 9:5970751-5970773 CAGCCTGTCCATTTTTTAACTGG - Intronic
1051799198 9:20912557-20912579 TAGCAGGTAGATTTTTTAAATGG + Intronic
1052149500 9:25097046-25097068 CAGAGTGAACATTTTTTAAAAGG - Intergenic
1052345511 9:27405401-27405423 CAACCTGTCCATTTTTTAAATGG + Intronic
1052564254 9:30127173-30127195 CTGCATGTACGTCTTTGACATGG - Intergenic
1052968176 9:34358317-34358339 CAGTATTTCCTTCTTTTAAATGG + Intergenic
1055128971 9:72752983-72753005 CTCCATTTACATGTTTTAAATGG - Intronic
1055596676 9:77872663-77872685 CAGCGTTTACATCTGTGAAATGG - Intronic
1056090070 9:83196529-83196551 CAGCATCTTCATCTTATCAAGGG - Intergenic
1056983624 9:91340854-91340876 CAGCTTTTACATCTTTTCTAAGG + Intronic
1057735358 9:97653471-97653493 CAGGATGTACAGCTTTTTGAGGG - Intronic
1058003395 9:99890224-99890246 GAGCAACTACATCTTTTAAAAGG + Intergenic
1058599069 9:106649830-106649852 CAGAATGTAGATCTATTAGAAGG - Intergenic
1059670613 9:116488078-116488100 CATCATGTACATCCTGTACATGG - Intronic
1061343869 9:130006143-130006165 CAGCCTGTACCTGTTTTTAATGG - Intronic
1061394208 9:130334402-130334424 CAGCTTGTCCATCTGTAAAATGG + Intronic
1061996164 9:134187197-134187219 CAGCATGCCCATCTGTAAAATGG - Intergenic
1186972022 X:14857049-14857071 TAACATGTGCAACTTTTAAATGG + Intronic
1187571074 X:20502687-20502709 CAGGATTTCCTTCTTTTAAAAGG + Intergenic
1187727857 X:22222442-22222464 CAGCATCTTCATCTGTGAAACGG + Intronic
1188449114 X:30290448-30290470 CAGCATGTCCCTCTTTTTTAAGG + Intergenic
1190068205 X:47257753-47257775 CAGAATGTGCAACTTTTAAAAGG - Intergenic
1190522655 X:51295994-51296016 CAGCCTGTTAATCTGTTAAAAGG + Intergenic
1190525889 X:51329172-51329194 CAGCCTGTTAATCTGTTAAAGGG + Intergenic
1190543589 X:51502489-51502511 CAGCCTGTTAATCTGTTAAAGGG - Intergenic
1191051784 X:56201276-56201298 CAGAATTTACTTCTTTTTAAAGG - Intergenic
1193610702 X:83628754-83628776 CAGCATTTGCTTATTTTAAAAGG + Intergenic
1194799874 X:98259597-98259619 CTGTATGTACACCTTTTACAAGG + Intergenic
1194938727 X:99983529-99983551 TAGCATCTAAATCTTTTGAAAGG - Intergenic
1195301932 X:103538537-103538559 CTGGATGCCCATCTTTTAAAAGG + Intergenic
1195463350 X:105152782-105152804 CAGAATGTGCTTCTTATAAAAGG + Intronic
1195801538 X:108717342-108717364 GAGCATGGATATATTTTAAATGG + Intergenic
1195928919 X:110053784-110053806 CAGCATGATCCTCTCTTAAATGG + Intronic
1196753769 X:119140229-119140251 CGGCCTGTGCATTTTTTAAATGG - Intronic
1196760138 X:119193598-119193620 CTGTTTTTACATCTTTTAAAAGG - Intergenic
1196939538 X:120761774-120761796 CAGTAGCCACATCTTTTAAAAGG - Intergenic
1197399179 X:125968311-125968333 CAGCATGTTTTTCTTTTATATGG + Intergenic
1197824615 X:130575487-130575509 AATCATGTAAATATTTTAAAGGG + Intergenic
1198137547 X:133769050-133769072 CAGGATGTTCTTCTTTTAAAAGG - Intronic
1198653448 X:138888750-138888772 CAGCAGGAAGATCTTTTAAAGGG - Intronic
1199350990 X:146799659-146799681 CTGCATGTAAATATTTAAAAAGG + Intergenic
1199568356 X:149242106-149242128 CAGGATTTTCTTCTTTTAAAAGG - Intergenic
1199761720 X:150909802-150909824 CAGCCTGTCCATTTTTTAATTGG - Intergenic