ID: 1008687035

View in Genome Browser
Species Human (GRCh38)
Location 6:53936817-53936839
Sequence GATCATGTGAACCACAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008687035 Original CRISPR GATCATGTGAACCACAGTGT TGG Intronic
901009069 1:6188560-6188582 GATGAAGTGCACCACAGTCTTGG + Intronic
903999123 1:27328351-27328373 GATAATTAGCACCACAGTGTTGG + Intronic
904796730 1:33061993-33062015 GATCATGGGAATCTCAGAGTGGG + Intronic
905138024 1:35815396-35815418 GATCTTGTGGAGCACAGTCTGGG - Intronic
907236954 1:53058712-53058734 GATCAAGTGAAACAGTGTGTGGG + Intergenic
908045569 1:60164328-60164350 GATCATCTTAACGACAATGTAGG - Intergenic
908784900 1:67725220-67725242 GAGTATCTGCACCACAGTGTTGG - Intronic
910652064 1:89580454-89580476 GAACATGTGAAAAACAGTTTAGG - Intronic
912200802 1:107455435-107455457 GATCAAGTGAACCTGAGGGTTGG + Intronic
916470208 1:165116480-165116502 GGGCATGTGAAACACAGTTTGGG - Intergenic
916904302 1:169265059-169265081 TATCATGAGAACAGCAGTGTGGG + Intronic
918626369 1:186660378-186660400 TATCATGAGAACCACATTATGGG + Intergenic
919716523 1:200783461-200783483 GAAAATGTGAACCACAGATTAGG - Intronic
920131497 1:203735538-203735560 GATCATGTGAACCACAGACAAGG - Intronic
921322526 1:213955925-213955947 GAAAATGTGAATCACAGTGTGGG - Intergenic
1063741950 10:8832793-8832815 GGTGATGTGAACCACAGAGCAGG - Intergenic
1065451933 10:25868313-25868335 GATCATGTGCACTCCAGTCTGGG + Intergenic
1065573265 10:27093949-27093971 GATCATGGGAACTACAATTTGGG - Intronic
1065633798 10:27710131-27710153 GAACAAGTGAACCACTCTGTGGG + Intronic
1074383489 10:112999101-112999123 GATCATTTGAACCCAAGAGTTGG - Intronic
1075566574 10:123509382-123509404 GAGCATGGGGACCACAGTTTAGG + Intergenic
1077835105 11:5919810-5919832 GACGATGTGAAACATAGTGTTGG + Intronic
1078437060 11:11334064-11334086 GAGCATATGGACCACAGTGTCGG - Intronic
1081689664 11:45069272-45069294 GCTCATGTGAACCAAAGCCTTGG - Intergenic
1083059773 11:59857762-59857784 GAGCATATGCACGACAGTGTAGG + Intronic
1090562718 11:127949831-127949853 GATCATGAGAACAGCAGAGTGGG + Intergenic
1091119705 11:133046676-133046698 GGACAAGTGAACCACAGTATGGG - Intronic
1091819994 12:3469066-3469088 CATCATTTGAAACACAGTGGAGG + Intronic
1099767505 12:87006796-87006818 TATCATGAGAACAGCAGTGTGGG - Intergenic
1099913793 12:88866478-88866500 GACAATGTGAAGCACAGTTTTGG - Intergenic
1101656835 12:106729865-106729887 GATCCTGTGAACCACTGAGGAGG - Intronic
1102133102 12:110548998-110549020 GGTGCTGAGAACCACAGTGTAGG + Intronic
1106672824 13:31925321-31925343 GATCATGTCAAACAGAATGTTGG + Intergenic
1110200902 13:72849194-72849216 AATCATGAAAAACACAGTGTTGG + Intronic
1110789468 13:79571334-79571356 GATCCTGAGAACAACAGTGAAGG - Intergenic
1112032326 13:95468637-95468659 GATCATTTGAACCCCAGAGGTGG + Intronic
1113928547 13:113954160-113954182 TATCATGTGCACCACAGGGACGG + Intergenic
1118771285 14:68944278-68944300 GATGATGTGTGCCAGAGTGTGGG + Intronic
1119996512 14:79259343-79259365 GATCATGTGAAACAGAAGGTAGG - Intronic
1120337182 14:83171768-83171790 CATGATTTGAACCACAGTATAGG + Intergenic
1124018460 15:25898412-25898434 GATCTGGTGAATCACTGTGTGGG + Intergenic
1126374106 15:47977196-47977218 GATCTTGTCACCCACAGTATGGG + Intergenic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1132063478 15:98711900-98711922 GCTTCTGTGAACCAGAGTGTGGG - Intronic
1135606600 16:23831304-23831326 GATCATTTGAACCTGAGAGTTGG - Intergenic
1135960299 16:26989411-26989433 GATCATTTGAGCCTCAGAGTTGG + Intergenic
1135997722 16:27265045-27265067 GATTATGAAAACCACAGTGAAGG + Intronic
1138860885 16:60755186-60755208 GATAATGTGAACCATGGTGGTGG + Intergenic
1139160023 16:64493908-64493930 CCTCATGTGATCCCCAGTGTGGG + Intergenic
1144812863 17:18011907-18011929 GATCATGTGAACCCAGGTGGTGG - Intronic
1145016143 17:19399575-19399597 AATCATTTGAACCAGAGGGTCGG + Intergenic
1147386312 17:40084408-40084430 GACCATGTCAACAACAGTTTGGG - Intronic
1152771262 17:82170961-82170983 TATCAAGTGAAACACAGTGTAGG + Intronic
1153052604 18:914341-914363 GATCATGTGAACAGTAGGGTTGG - Intergenic
1154145148 18:11860992-11861014 GCGCCTGTGAACCTCAGTGTGGG - Intronic
1154387723 18:13910836-13910858 AATCATGCCAACCACAGTGGGGG + Intronic
1159718187 18:71851137-71851159 GCCCATGTGGAGCACAGTGTGGG - Intergenic
1165550591 19:36581549-36581571 GGACATGTGACCCCCAGTGTTGG + Intronic
1166400164 19:42472827-42472849 GATCATGTAAATCACAATGTTGG + Intergenic
927888812 2:26735539-26735561 GATCATCAGAACAACACTGTGGG + Intergenic
928805275 2:35142416-35142438 GATCGTGTGAACCCTAGAGTTGG - Intergenic
933016296 2:77131510-77131532 GAACATTAGAACCACAGTTTTGG - Intronic
935422488 2:102884299-102884321 TATCATGTGAGCCACAGATTTGG + Intergenic
936473769 2:112822243-112822265 GTTCATGTGAATCACAACGTAGG - Intergenic
938097494 2:128473180-128473202 CTTCCTGTGAACCACAGGGTGGG - Intergenic
939574013 2:143874343-143874365 TATCATTTGATCCCCAGTGTTGG - Intergenic
939612343 2:144326806-144326828 GATCATGTGTACCCCAGGGTTGG - Intronic
940549013 2:155127917-155127939 CATTATGTGAAACAGAGTGTAGG + Intergenic
943204673 2:184878254-184878276 GATTATGTGAGCCAAAGAGTAGG + Intronic
945277645 2:208004329-208004351 GATCATTTGAACCAGAGAGTCGG + Intronic
946618738 2:221537701-221537723 GATCATTTGAACCTAAGAGTTGG + Intronic
947381443 2:229549390-229549412 GATCATGTGAACCCTGGAGTCGG - Intronic
948110330 2:235449727-235449749 CATCAAGTGAGCCACAGAGTGGG - Intergenic
1169632704 20:7650751-7650773 CTTCATGTGAACCAGAGTTTGGG - Intergenic
1170195373 20:13683780-13683802 GAGCATTTCTACCACAGTGTAGG + Intergenic
1183074160 22:35416176-35416198 AATCATGGGAACAACTGTGTGGG - Intronic
951519059 3:23594325-23594347 GCTCATGTGACCAACAGTCTTGG - Intergenic
953304692 3:41817129-41817151 GTTCATTTGGACCACTGTGTAGG - Intronic
953926750 3:46986424-46986446 GAGGATGTGAACCACAGAGGGGG + Intronic
959034847 3:101349101-101349123 GTTCATGTGAATCACGGGGTTGG - Intronic
961938810 3:130615293-130615315 AATCATATCAACCACAGTCTTGG - Intronic
963929727 3:150991269-150991291 GACCATGTGTATCACAATGTTGG - Intergenic
965295525 3:166941345-166941367 TGCCATGTGAACCACATTGTGGG - Intergenic
967324092 3:188221556-188221578 AATCATGGGAACCCCAGTATGGG - Intronic
967686153 3:192419021-192419043 TAACATGTGAATAACAGTGTTGG - Intronic
968707889 4:2091604-2091626 GATCAACGGAATCACAGTGTGGG - Intronic
970090002 4:12395273-12395295 GATAATCTGAACCCCAGTGGAGG - Intergenic
971877919 4:32328252-32328274 TATCCTGAGAACCACAGTCTGGG + Intergenic
974348065 4:60707781-60707803 TATTATGTGAACCACATTTTTGG + Intergenic
976474797 4:85471836-85471858 AATCATGTGATCCAAAGTGTTGG + Intergenic
978405723 4:108376821-108376843 GTTGATGTGAAGCACAGTTTTGG - Intergenic
978989114 4:115055875-115055897 GTTCATGTTACTCACAGTGTGGG + Intronic
979268691 4:118733873-118733895 GGTCATGTGAGCCAAAGTGAGGG - Intronic
983849135 4:172558572-172558594 GATCAAGTTGCCCACAGTGTTGG - Intronic
984944103 4:184957799-184957821 CATGATGTGATCCCCAGTGTTGG - Intergenic
985728346 5:1527248-1527270 GTTCCTGAGAACCACAGTGGGGG - Intergenic
989214634 5:38891919-38891941 GATCATGTGATCTGCAGTCTGGG - Intronic
990318538 5:54607448-54607470 CATCATTTGAACCATAGTTTAGG + Intergenic
990479193 5:56191704-56191726 CATAAAGTGAAGCACAGTGTAGG + Intronic
992531498 5:77655988-77656010 GATCAAATGAAACAAAGTGTTGG - Intergenic
995587506 5:113663417-113663439 GCTCATGAAAACAACAGTGTGGG + Intergenic
996975359 5:129426763-129426785 GATGATGTGTACGTCAGTGTGGG - Intergenic
999434567 5:151553227-151553249 GACCCTGTGAACCACATGGTGGG - Exonic
1000247430 5:159460296-159460318 GAGCATGTGAATCTCAGAGTGGG - Intergenic
1000509291 5:162162453-162162475 GGAAATGTGAACCCCAGTGTTGG + Intergenic
1002982875 6:2159304-2159326 GATCATGTGAGCCCAAGAGTAGG - Intronic
1004560296 6:16743411-16743433 GGTCCTGTGAACCACAGTGGTGG - Intronic
1008338416 6:50334914-50334936 GATAATGGTAGCCACAGTGTAGG + Intergenic
1008687035 6:53936817-53936839 GATCATGTGAACCACAGTGTTGG + Intronic
1009319532 6:62270113-62270135 TAAAATGTGATCCACAGTGTTGG + Intronic
1010429402 6:75761793-75761815 GAACATGTGGACAACAGAGTAGG + Intronic
1011479823 6:87782932-87782954 AATCATGTGTACCAGAGAGTGGG + Intergenic
1013059247 6:106616003-106616025 GATCATTTGAACCACAGAGTTGG - Intronic
1013771595 6:113633933-113633955 GATCATGTGCACCCCACTTTGGG + Intergenic
1015047263 6:128790436-128790458 GAAAATGTGACCCCCAGTGTTGG - Intergenic
1016838088 6:148499391-148499413 GAGCATTTGAACCAAAGTGTAGG + Intronic
1020698739 7:11449652-11449674 CATCATCTGTAACACAGTGTAGG + Intronic
1021125092 7:16842744-16842766 GATCACTTGAACCAAGGTGTTGG - Intergenic
1027536561 7:79410395-79410417 CATAATGTGAAACACACTGTTGG - Intronic
1028021279 7:85777151-85777173 GAACAGGTGAACCACAGACTGGG + Intergenic
1032584647 7:133134973-133134995 CATTATGTCAACCACAGTGTGGG - Intergenic
1033032882 7:137844869-137844891 GATTACATGAAGCACAGTGTAGG - Intronic
1044238566 8:89860735-89860757 GAGCTTGTGAACCAAAATGTGGG - Intergenic
1045146278 8:99347850-99347872 GCAGATGTGAACTACAGTGTGGG - Intronic
1047786392 8:128157811-128157833 GCACATGGGAACCACAGTGAAGG - Intergenic
1048078720 8:131101690-131101712 AATCATGAGAACAACAGTATGGG + Intergenic
1051329496 9:16008899-16008921 CATCATGTGAATTCCAGTGTCGG + Intronic
1051883547 9:21865188-21865210 TATCATGAGAACAGCAGTGTGGG - Exonic
1052533545 9:29718987-29719009 AATCATGTGAAGCAAAGTCTGGG - Intergenic
1055552392 9:77443893-77443915 GATCATTTGAACCCAGGTGTTGG + Intronic
1057142743 9:92737475-92737497 GATCCTGACAACCCCAGTGTGGG + Intronic
1057576522 9:96246900-96246922 TATCATGGGAACCTCAGTGTTGG - Intronic
1057586448 9:96332983-96333005 AATCACTTGAACCACAGAGTTGG - Intronic
1058129022 9:101228297-101228319 GAGCATTTGAACCACAGCTTTGG - Intronic
1059514356 9:114879097-114879119 TATCATGAGAACAGCAGTGTGGG - Intergenic
1060146354 9:121255941-121255963 AATCATGTAAAGCACTGTGTGGG - Intronic
1061132575 9:128716209-128716231 GATCACTTGAACCTCAGTGGCGG + Intronic
1190161276 X:48033052-48033074 GATGATGGGAACCACACTGTTGG + Intronic
1190340177 X:49290215-49290237 CCTGGTGTGAACCACAGTGTAGG + Intronic
1190579375 X:51876036-51876058 GGTCATGTGACCCACACTATGGG - Intronic
1194872951 X:99155485-99155507 AATCATATCAACCACAGTCTTGG + Intergenic
1200724110 Y:6644722-6644744 GATTATGTGAACTAGAGTATAGG + Intergenic