ID: 1008691804

View in Genome Browser
Species Human (GRCh38)
Location 6:53987544-53987566
Sequence TACTTAGTTGCCTCTCTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008691804_1008691808 22 Left 1008691804 6:53987544-53987566 CCTTTAAGAGAGGCAACTAAGTA 0: 1
1: 0
2: 2
3: 8
4: 117
Right 1008691808 6:53987589-53987611 TACCACTGCTGTAGACAAGAAGG No data
1008691804_1008691805 -5 Left 1008691804 6:53987544-53987566 CCTTTAAGAGAGGCAACTAAGTA 0: 1
1: 0
2: 2
3: 8
4: 117
Right 1008691805 6:53987562-53987584 AAGTAGCACCCTAGTCTAGTCGG 0: 1
1: 0
2: 0
3: 2
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008691804 Original CRISPR TACTTAGTTGCCTCTCTTAA AGG (reversed) Intronic
903033185 1:20477668-20477690 TACTTTGTTGCCTCTCACATTGG - Intergenic
903045768 1:20563253-20563275 TACTTACTGGCCTTCCTTAAAGG + Intergenic
908169318 1:61488878-61488900 GACTTAGGTGCCTCTCCTCAGGG - Intergenic
908905594 1:69005351-69005373 TGCTTAGATTCCTCTCTCAATGG + Intergenic
909287091 1:73833448-73833470 TATTTAGTAGCATCTCTTAAAGG - Intergenic
910167765 1:84345646-84345668 TGCCTAGTTGCCTGTCTTGATGG + Intronic
912798323 1:112706083-112706105 GGCTCAGTTGCCCCTCTTAAGGG - Exonic
913157388 1:116113372-116113394 TCCTTATTTATCTCTCTTAATGG - Intronic
914227857 1:145736379-145736401 TACTAACTTGCCTCTCTCACAGG - Intronic
916871956 1:168925068-168925090 CATTTAGTTTCCTCTCTCAATGG + Intergenic
918347765 1:183621210-183621232 TGCTAAATTGCCTTTCTTAAAGG - Intergenic
920652198 1:207846421-207846443 TATTGGGTTGCCTGTCTTAATGG - Intergenic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
1063075082 10:2708200-2708222 TACTTTTTTGCCTCTATTACTGG + Intergenic
1065663510 10:28032827-28032849 TGTTCATTTGCCTCTCTTAAAGG - Intergenic
1072990894 10:100192264-100192286 TACTTTTTTGCCTTTATTAAAGG - Intronic
1076057158 10:127385145-127385167 GACTTAGTTCCCTCTGGTAAGGG - Intronic
1079810448 11:24992498-24992520 AACTTAGTTGCCTATTTTCATGG - Intronic
1082221529 11:49644349-49644371 TACTTACTTACCTCATTTAATGG + Intergenic
1085762514 11:79254492-79254514 TCCTTAGCTGCCTCTCTCCAAGG - Intronic
1086627514 11:88974804-88974826 TACTTACTTACCTCATTTAATGG - Intronic
1093558823 12:20512706-20512728 TACTCAGGTGCCTCTGATAATGG - Intronic
1096635000 12:52952516-52952538 TACTTAGTTTGCTTTCTTCAAGG - Intronic
1099301714 12:80903468-80903490 TTCTTAGTTGTTTCACTTAATGG + Intronic
1099630397 12:85135377-85135399 TATCTGGTTGCCTCTCTTTAAGG + Intronic
1101185058 12:102267379-102267401 TATTTATTTGTCTCTGTTAATGG + Intergenic
1104208781 12:126666768-126666790 TACTTATTTTTCTCTCTTCAAGG - Intergenic
1109186766 13:59278884-59278906 TACTTTGTTCCCTCTCTTAAGGG + Intergenic
1112912903 13:104510356-104510378 TACATAGATGCCTCTCTTAAGGG + Intergenic
1114856925 14:26458592-26458614 TGTTTAGTTCCCTCTCATAAGGG - Intronic
1115617952 14:35114106-35114128 TATTTAGCTGCCTCTGTTTAAGG + Intronic
1116020289 14:39452579-39452601 TACTTAGTAGCCTTTTTTAATGG - Intergenic
1116672906 14:47866297-47866319 TACTTATTTGCATATATTAAAGG + Intergenic
1120377063 14:83722460-83722482 TACCTAATTCACTCTCTTAAAGG + Intergenic
1120669609 14:87348794-87348816 TTCTCTGTTGCTTCTCTTAAAGG - Intergenic
1124555088 15:30718044-30718066 TACCTAGATGCCTATCTGAATGG - Intronic
1124676163 15:31687638-31687660 TACCTAGATGCCTATCTGAATGG + Intronic
1134426802 16:14156795-14156817 TCTTTAGTTGTCTCTTTTAAAGG - Intronic
1135220918 16:20613375-20613397 TGCTTGGTTGGCTATCTTAAAGG + Intronic
1138906794 16:61346106-61346128 TTCTTACTTGCACCTCTTAAAGG - Intergenic
1155584110 18:27345109-27345131 TACTTTGTCGTCTCTCATAAAGG + Intergenic
1157372710 18:47131334-47131356 TTCCTATTTGCCTCTCTTATTGG + Intronic
1157968274 18:52235231-52235253 TACCTAGTTCCCAGTCTTAAAGG - Intergenic
1158761056 18:60387475-60387497 TATTTACTTGTTTCTCTTAAGGG - Intergenic
1158846694 18:61451088-61451110 TGATTAGTTGCCTTTCTGAAAGG - Intronic
925646136 2:6038731-6038753 TCCTTAGGTGCCTCTCTGAAAGG + Intergenic
932426682 2:71641989-71642011 TATTTAGTTGTCACTGTTAATGG + Intronic
934082557 2:88481736-88481758 TCCTTTGTTACCTCTCTTATGGG - Intergenic
938205690 2:129420898-129420920 TTCTTATTTGCCTCTCCTAATGG + Intergenic
940021607 2:149161873-149161895 TACTAAGATGCCTTTCTAAATGG + Intronic
941830481 2:169952947-169952969 TAATTAGTGGTCTCTCTTAGTGG + Intronic
942102562 2:172600190-172600212 TACTTAGATGTCTCTCATTATGG + Intronic
942426224 2:175863491-175863513 TAAGAAGTTGCCTCTCTTAATGG + Intergenic
945223203 2:207505314-207505336 TACTTCATTGACTTTCTTAAGGG - Intergenic
1169230442 20:3885033-3885055 TACTTAACTGTCTCTCTCAAAGG - Intergenic
1169457567 20:5765562-5765584 TGCTTATTTTCCTCTCTTAAGGG - Intronic
1169655508 20:7918346-7918368 TTCTTTATTGCCTCTCTGAATGG - Intronic
1172192834 20:33072222-33072244 TAGTCTGTTGCCTCTCTTTATGG + Intronic
1178608946 21:34063563-34063585 TACTTAGTTGTCTCAATTAGTGG + Intergenic
950939645 3:16880257-16880279 TAGTTAGTTCATTCTCTTAAGGG - Intronic
951108006 3:18768420-18768442 TACCTACTAGCCTCTCTTTATGG - Intergenic
953734430 3:45479587-45479609 TGCTTTTTTTCCTCTCTTAAAGG - Intronic
956756388 3:72392039-72392061 TACTTCTTTCCCTCTTTTAACGG - Intronic
957618028 3:82556941-82556963 TTTTTAGTTGCCTTTTTTAAAGG + Intergenic
961409775 3:126711541-126711563 ATCTTAGTTGACTCACTTAAAGG + Intronic
965193088 3:165556860-165556882 TATTTAATTACCTCTCTTTAGGG + Intergenic
968860950 4:3169361-3169383 TCCTTTTTTCCCTCTCTTAAAGG + Intronic
969257927 4:6015226-6015248 AACTTAATTGCCTCTTTGAAAGG - Intergenic
972722600 4:41715392-41715414 TGCTTAGTTTCCTCTTTTGAAGG + Intergenic
974338556 4:60584267-60584289 TCCTTAGTTGCCTCTACTTAAGG - Intergenic
975075237 4:70198807-70198829 TACTTAGCTGCCTGTCCTTAAGG - Intronic
975625588 4:76343508-76343530 TACTTTCTTGCTTCTCTTTAAGG - Intronic
976507279 4:85862972-85862994 TATTTACTTGCCTGTTTTAATGG - Intronic
977200900 4:94114613-94114635 TACTTTATTGCCTCTCTTATTGG - Intergenic
977479727 4:97560448-97560470 TAGTTCTTTCCCTCTCTTAAAGG - Intronic
977920942 4:102641896-102641918 TATCTAGTAGCCTCTCTTACAGG + Intronic
981097914 4:140800518-140800540 TGCCTAGTTTTCTCTCTTAAAGG + Intergenic
981427354 4:144618769-144618791 TTCTTTGGTGCCTCTCTTGAGGG - Intergenic
982124458 4:152172603-152172625 CACATAGTTGCTTCTCTTCAAGG + Intergenic
983159713 4:164397300-164397322 TACTTAGTAACTTCTCTTCAAGG + Intergenic
987354005 5:17046323-17046345 GACTTACTTGCTTCTCTCAAAGG - Intergenic
987637391 5:20562628-20562650 TAATTATTTTCTTCTCTTAAAGG + Intronic
988862426 5:35297300-35297322 TACATTGTTGCCAGTCTTAAAGG + Intergenic
989180984 5:38576739-38576761 TAGTTAGTTGCCTGTGATAAAGG + Intronic
990414220 5:55570898-55570920 AATTTAGTGGTCTCTCTTAAGGG - Intergenic
993322764 5:86494380-86494402 TATTTAGCTCCCTCTTTTAAGGG + Intergenic
994500988 5:100577768-100577790 TACTTAATTTTTTCTCTTAAAGG + Intronic
996083465 5:119280257-119280279 TACTTCCTTGCATCTCTTTATGG + Intronic
996858468 5:128037861-128037883 CACTGATTTGCCTCTGTTAAAGG - Intergenic
998870156 5:146543912-146543934 TATTTTTTTTCCTCTCTTAAGGG + Intergenic
999018255 5:148133296-148133318 TACTTGTTTGCCTCTGGTAATGG - Intronic
999848792 5:155515141-155515163 AACTTAATTGCCTCTGTGAACGG + Intergenic
1000471041 5:161642327-161642349 ACCTTAGTTGCCTCTTTAAAAGG + Intronic
1000803232 5:165754855-165754877 AACTTAATTACCTCTGTTAAGGG + Intergenic
1003811467 6:9787361-9787383 TACTGAGTTGACTCTGATAATGG - Intronic
1003880828 6:10478174-10478196 TACATAGTAGCCTTTCCTAAGGG + Intergenic
1005230307 6:23693742-23693764 TAATTCGTTGCCTCTCTGATGGG + Intergenic
1007146066 6:39633321-39633343 TATTATGTTACCTCTCTTAAGGG - Intronic
1007448098 6:41922205-41922227 TACTTAATTGCCTCTCTGCTGGG - Intronic
1008691804 6:53987544-53987566 TACTTAGTTGCCTCTCTTAAAGG - Intronic
1011133448 6:84074938-84074960 TACTTAGTGGCTTCTGTTAACGG + Intronic
1013606148 6:111750566-111750588 TACTTGGTTACCTCTATTACAGG - Intronic
1014746577 6:125207996-125208018 TGCTCAGTTACTTCTCTTAAGGG - Intronic
1015630527 6:135227775-135227797 TACTCAGTTGTGTCACTTAAAGG + Intergenic
1016072627 6:139758292-139758314 TACTTATCTGCCTCTCTTTCTGG + Intergenic
1026329707 7:69341156-69341178 TACTTATTTGTCTCCCTTGAAGG - Intergenic
1028728229 7:94113933-94113955 TACTCAGGTGGCTCTGTTAAAGG - Intergenic
1029323543 7:99785970-99785992 TCCTTAGGTGCCTCTCTGTACGG - Intergenic
1031304659 7:120111160-120111182 TTCTGAGTTGTCTCACTTAAGGG + Intergenic
1034011985 7:147538812-147538834 TACTTAGTTTCATCAATTAAAGG + Intronic
1036972001 8:13365858-13365880 CACTTAGGTGCCTCTCATATGGG - Intronic
1036991170 8:13596473-13596495 TCCTTAGAGGCCTTTCTTAAAGG + Intergenic
1037125914 8:15348802-15348824 AACTTAGTAGCCTTTCTAAAAGG - Intergenic
1043401385 8:79888495-79888517 TACTTGCTTGCCTTTCTAAATGG + Intergenic
1044865440 8:96566201-96566223 TTCTTAGATGTTTCTCTTAAAGG + Intronic
1050578205 9:7021683-7021705 TACTTCGTTGCCTGTGTTTATGG + Intronic
1050737346 9:8779303-8779325 TACTTGGTTGCCTTGGTTAATGG - Intronic
1051016410 9:12480918-12480940 TCCTTAGTTTCCTATCATAAAGG + Intergenic
1051730371 9:20136119-20136141 TATTGAGTTGCCTCTCTTCCAGG - Intergenic
1186252643 X:7685186-7685208 TACATAATAGCATCTCTTAATGG - Intergenic
1187357743 X:18593559-18593581 AACCTAGGTGCCTCTCCTAAGGG - Intronic
1189183168 X:39023485-39023507 TACTTTGTTCCCGATCTTAAGGG + Intergenic
1189842032 X:45090201-45090223 TACTTTGTTTTCTCTCATAAGGG - Intronic
1194636856 X:96355803-96355825 TATTTAGTTGCCTGTGTTTATGG - Intergenic
1196421174 X:115523218-115523240 TACTTTTTTTCCTCTTTTAATGG + Intergenic
1197240611 X:124119128-124119150 TACCTTCTTGCCTCCCTTAAAGG - Intronic
1197692048 X:129512597-129512619 GACTTAGTTCCCTTTCTTATGGG - Intronic
1201322820 Y:12719296-12719318 TTCTTATTTGTCTCTCTCAAGGG + Intronic