ID: 1008697899

View in Genome Browser
Species Human (GRCh38)
Location 6:54062889-54062911
Sequence GTGCAGGGCTAGAATTAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008697896_1008697899 28 Left 1008697896 6:54062838-54062860 CCTATCACAAAGTGGGTGCTTAG 0: 1
1: 0
2: 5
3: 63
4: 546
Right 1008697899 6:54062889-54062911 GTGCAGGGCTAGAATTAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008697899 Original CRISPR GTGCAGGGCTAGAATTAATA TGG Intronic
No off target data available for this crispr