ID: 1008699399

View in Genome Browser
Species Human (GRCh38)
Location 6:54080496-54080518
Sequence CACTTTCTATTTAATATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008699398_1008699399 -3 Left 1008699398 6:54080476-54080498 CCTTATTTTTACAATCATTTCAC 0: 1
1: 0
2: 1
3: 48
4: 507
Right 1008699399 6:54080496-54080518 CACTTTCTATTTAATATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008699399 Original CRISPR CACTTTCTATTTAATATCAA TGG Intronic
No off target data available for this crispr