ID: 1008700342

View in Genome Browser
Species Human (GRCh38)
Location 6:54091745-54091767
Sequence CTGGAGGCCTAGGGTTTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008700342 Original CRISPR CTGGAGGCCTAGGGTTTAGA AGG (reversed) Intronic
900786404 1:4653273-4653295 CTGGAGGCCTGGGGGTGAAAGGG + Intergenic
901198214 1:7452076-7452098 CTTGAGGCCTCCAGTTTAGAGGG - Intronic
901449484 1:9327161-9327183 GTGGAGGCCGTGGGCTTAGAGGG - Intronic
906547884 1:46634670-46634692 CTGGGGGCCTTGGGTTCAGAAGG + Exonic
907286504 1:53383836-53383858 CTGGGAGCCTAAGGTTTTGAGGG + Intergenic
908522307 1:64956204-64956226 CTGCTGGCCTAGGGTTTTCAGGG + Intronic
909198389 1:72656508-72656530 CTGCATGCCTAGGGTTTCAATGG - Intergenic
910352978 1:86320898-86320920 GTGGAGGCCTAGGGGTAAGCTGG + Intergenic
911279121 1:95900995-95901017 TTAGAGGCCTAAGATTTAGAGGG - Intergenic
914452074 1:147801397-147801419 CTCTAGGCCTTGGGCTTAGATGG - Intergenic
915100951 1:153499762-153499784 CTAGAGAACTAGGGTTTAGAAGG + Intergenic
919396119 1:197050726-197050748 AGGGAGGCCTATTGTTTAGATGG - Exonic
920500930 1:206485083-206485105 CTGGAGGGCAAGGGCTTAGCAGG + Intronic
922124550 1:222710035-222710057 CTGGATGTCGAGGGTGTAGAAGG - Intronic
923746372 1:236704490-236704512 CTGGAGGCCTGGACTTGAGATGG - Intronic
1062837280 10:643964-643986 CTGGAATCATAGGATTTAGAGGG - Intronic
1062973011 10:1662668-1662690 CTGGAAGCCATGGGTTTCGAGGG - Intronic
1066798394 10:39153135-39153157 ATGGAGGCCTATGGTTAAAAAGG + Intergenic
1066822021 10:39507077-39507099 CTTGAGGCCTACGGTTGAAACGG + Intergenic
1068359095 10:55952641-55952663 CTTTAGGCATAGGGTTTACAGGG - Intergenic
1068949161 10:62760242-62760264 CTGGAGGCCAAGGTCCTAGAAGG + Intergenic
1069643044 10:69968601-69968623 CTGGAGGCCTTGGGGGCAGAGGG - Intergenic
1070766353 10:79058650-79058672 CTGGAGGCCAGGGGACTAGAAGG - Intergenic
1072152078 10:92691320-92691342 CTGGAGCCCTAGGGTAAATAAGG + Intronic
1078845143 11:15113715-15113737 CTGGGGGCCCAGGGCTCAGAAGG - Intronic
1080865349 11:36189540-36189562 ACGTAGGCCTAGGGTGTAGATGG - Intronic
1081585043 11:44378452-44378474 CTGGAGGTCTAGGGTTCAAATGG + Intergenic
1082128428 11:48457752-48457774 CTGGAGGCCTATGGGGTTGAGGG + Intergenic
1082155671 11:48807741-48807763 TTTGAGGCCTATGGTTTAAAAGG + Intergenic
1082163661 11:48914860-48914882 TTTGAGGCCTAGGGTTGAAACGG - Intergenic
1082309263 11:50626571-50626593 CTTGAGGCCTATGGTTAAAAAGG + Intergenic
1082571899 11:54751880-54751902 CTGGAGGCCTATCGTGTAAAAGG + Intergenic
1082580351 11:54858981-54859003 TTTGAGGCCTAGGGTTCAAAAGG + Intergenic
1082592628 11:55032032-55032054 CTGGAGGCCTATGGTGAAAAAGG - Intergenic
1082603423 11:55191677-55191699 CTTGAGGCCTATGGTTAAAAAGG - Intergenic
1082606909 11:55248765-55248787 TTTGAGGCCTAGGGTGTAAAAGG - Intergenic
1084312950 11:68327170-68327192 CTGGAGGACTTGGCTTTGGAGGG - Intronic
1084484375 11:69439289-69439311 CTGGAGGCCTTGGGGGTGGAGGG - Intergenic
1085284234 11:75349836-75349858 CTGGAGGCCCAGGCTTTGGGGGG - Intronic
1086229267 11:84548773-84548795 CTGCTGACCTGGGGTTTAGATGG - Intronic
1089659037 11:119974009-119974031 CTGGAGGCCTTGGCTTGAGCAGG + Intergenic
1091584243 12:1806841-1806863 CTGGAGGCCTAGAGATAAGCAGG + Intronic
1093006158 12:14053557-14053579 CTTGAGGCCTAGGCTTGGGAGGG - Intergenic
1093691738 12:22116386-22116408 CTGGAGCCTTGGGGTTTATATGG + Intronic
1095031705 12:37293590-37293612 TTTGAGGCCTATGGTTTAAAAGG + Intergenic
1095031793 12:37295632-37295654 TTTGAGGCCTATGGTTTAAAAGG + Intergenic
1095058173 12:37643918-37643940 TTTGAGGCCTATGGTTTAAAAGG - Intergenic
1095078718 12:37969206-37969228 CTGGAGGCCTATGGTGAAAAAGG + Intergenic
1095079029 12:37973988-37974010 ATTGAGGCCTATGGTTTAAAAGG + Intergenic
1096769577 12:53926333-53926355 CTGCAGGCCCAGGATTTGGAGGG + Intergenic
1097391608 12:59021856-59021878 CTGGAAGTCAAGGGTTGAGAAGG - Intergenic
1100271454 12:93029237-93029259 CTGGAGCCCTGGGGGTGAGAGGG - Intergenic
1102112842 12:110378050-110378072 CTGTAGGGCTAGGTTTAAGATGG + Intronic
1108086923 13:46803490-46803512 CTGGAGGCCTAGACTTGCGACGG - Intergenic
1109799518 13:67358112-67358134 CTGGAAGCCTAGTGTTTATCAGG - Intergenic
1111647155 13:91045947-91045969 CTGGAGGCCTAGATAATAGAGGG + Intergenic
1114002298 14:18270320-18270342 CTTGAGGCCTATGGTTTAAAAGG - Intergenic
1116272419 14:42788626-42788648 CTGAAGGCCTAGGGTTGAGCAGG - Intergenic
1120110638 14:80551410-80551432 CTGTAGGTCTGGGGTTTATATGG - Intronic
1122769223 14:104090475-104090497 CTGGAGGCCGAGGCCTGAGAGGG + Intronic
1123386827 15:19819521-19819543 CTTGAGGCCTATGGTTTAAAAGG - Intergenic
1123386915 15:19821221-19821243 TTTGAGGCCTATGGTTTAAAAGG - Intergenic
1127009818 15:54611309-54611331 CAAGAGCCCTTGGGTTTAGAAGG + Intronic
1133179042 16:4038732-4038754 CTGGAGGCTTCTGGTTTGGATGG - Intronic
1133870727 16:9683276-9683298 CTTGAGGCTGAGGGTTTAAATGG + Intergenic
1134047869 16:11114574-11114596 CTGCAGGCAGAGGCTTTAGAGGG + Intronic
1137080458 16:36045548-36045570 TTGGAGGCCTATGGTATAAAAGG + Intergenic
1137081754 16:36069587-36069609 TTGGAGGCCTATGGTCTAAAAGG + Intergenic
1141641676 16:85345085-85345107 GAGGAGGCCTGGGGTTTAGGAGG - Intergenic
1141979736 16:87542407-87542429 TTGGAGACCTCTGGTTTAGAGGG - Intergenic
1141983681 16:87565763-87565785 CCGCAGGCCTGGGGTGTAGAGGG + Intergenic
1143019951 17:3912193-3912215 CAGGAGGAGTAAGGTTTAGAGGG - Intronic
1144311138 17:14015379-14015401 CTGGAGGCTCAGGGTTTCAATGG - Intergenic
1147531270 17:41280507-41280529 TTGGAGGCTTAGTGTATAGAAGG + Intergenic
1148324649 17:46776237-46776259 ATGGAGGCCCAGGGTGCAGATGG - Intronic
1149505925 17:57193912-57193934 CTTCAGGCCTCGGGTTCAGAAGG - Intergenic
1150823115 17:68451524-68451546 GTGGAGCCCTAGGGTCTGGAGGG - Intronic
1151138906 17:71973108-71973130 CTGTAGGCTTAGACTTTAGAGGG + Intergenic
1152309579 17:79541660-79541682 CTTGAGGCCTAGCGGTTTGATGG - Intergenic
1153415160 18:4838308-4838330 CTGGAGGCCCAGACTTGAGATGG - Intergenic
1154535341 18:15400091-15400113 TTTGAGGCCTATGGTTTAAAAGG + Intergenic
1154535395 18:15400953-15400975 CTTGAGGCCTATGGTTTAAAAGG + Intergenic
1157586841 18:48806467-48806489 CTGGGGGCATAGCGTTTGGATGG + Intronic
1160568881 18:79803300-79803322 CTGGAGGCCTAGAGGTGAGGGGG - Intergenic
1161504595 19:4636966-4636988 CGGGAGGGCTAGGGTTCAGTGGG - Intergenic
1164328108 19:24220427-24220449 ATGGAGGCCTAGGGTGAAAAAGG - Intergenic
1165073647 19:33269277-33269299 CTGGATGCCGAGGGAATAGAAGG + Intergenic
1165106052 19:33470213-33470235 CTGGAGGCCTAGAGGCTGGAGGG - Intronic
1165778810 19:38420386-38420408 CTGGAGGGTTGGGGTTTGGAGGG + Intronic
1166121514 19:40690107-40690129 CTGGAGGCCTTGGTTTGATACGG + Intronic
1167349284 19:48964715-48964737 CTGGAGTCCTGGGATTTACAGGG - Intergenic
1167452505 19:49580440-49580462 CTAGAGGCCTGGGGTCTTGAGGG - Intronic
926938264 2:18108007-18108029 CTGGAGGCATAGGTTTTTGAGGG + Intronic
929454443 2:42055970-42055992 CTGAAGCCCTGGGGTTTAGCTGG + Intronic
931586658 2:63837379-63837401 TGGGTGGCCTAGGATTTAGATGG + Intergenic
933924531 2:87078817-87078839 GTGCAGGCCTAGGTTCTAGAAGG - Intergenic
934358309 2:92539866-92539888 TTGCAGGCCTATGGTTTAAAAGG + Intergenic
934359057 2:92551934-92551956 TTGCAGGCCTATGGTTTAAAAGG + Intergenic
934367139 2:92680891-92680913 TTGCAGGCCTATGGTTTAAAAGG + Intergenic
934370571 2:92735948-92735970 TTTGAGGCCTATGGTTTAAAAGG + Intergenic
934371676 2:92753625-92753647 TTTGAGGCCTATGGTTTAAAAGG + Intergenic
934385438 2:92974541-92974563 TTTCAGGCCTAGGGTTTAAAAGG + Intergenic
934398033 2:93178450-93178472 TTGCAGGCCTATGGTTTAAAAGG + Intergenic
934422680 2:93575014-93575036 TTGCAGGCCTATGGTTTAAAAGG + Intergenic
934426510 2:93636374-93636396 TTGCAGGCCTATGGTTTAAAAGG + Intergenic
934431581 2:93717989-93718011 CTTCAGGCCTATGGTTTAAAAGG + Intergenic
934451169 2:94034662-94034684 TTGCAGGCCTATGGTTTAAAAGG + Intergenic
934453970 2:94079631-94079653 TTTGAGGCCTATGGTTTAAAAGG + Intergenic
934472643 2:94567909-94567931 CTTGAGGCCTATGGTTTAAAAGG - Intergenic
934472725 2:94569440-94569462 TTTGAGGCCTATGGTTTAAAAGG - Intergenic
937219959 2:120337055-120337077 CAAGAGGCATAGGGTTGAGATGG - Intergenic
937339612 2:121082687-121082709 CTGGAGGCCTAGGGTAGGGTAGG + Intergenic
938086179 2:128403521-128403543 TTGGAGGCTTAGGGTTGGGAAGG + Intergenic
938387340 2:130876216-130876238 CAGGCGGCCTAGGGTTTGGAGGG + Intronic
940035214 2:149305491-149305513 CTGTAATCCTAGTGTTTAGAGGG - Intergenic
942957985 2:181796625-181796647 CTGATGGCCTTGGGTTTATAAGG + Intergenic
946313478 2:218895558-218895580 ATGGAGGCCTAGGGTTGAGGGGG + Intronic
948238496 2:236408773-236408795 CTGGAGGCCTTGAGGTTTGAGGG + Intronic
949015147 2:241704793-241704815 CTGGGGGCAGAGGGTTTTGAGGG + Intronic
1171826910 20:29924020-29924042 CTTGAGGCCTATGGTGTAAAAGG + Intergenic
1171828688 20:29959058-29959080 TTGGAGGCCTATGGTGTAAAAGG + Intergenic
1172150392 20:32786441-32786463 CTGGAGGCCTGGGGTCTGGCGGG - Intronic
1174100702 20:48124251-48124273 CTGGAGCCCTAGGCATTAGCTGG - Intergenic
1174854305 20:54028540-54028562 CTGGAGTCCTTGGGCTTGGAGGG + Exonic
1175955332 20:62606078-62606100 CTGGAGGCCTTGAGTTACGAGGG - Intergenic
1179928769 21:44552788-44552810 CTGGAGGCCCCAGGTTCAGATGG - Intronic
1180426807 22:15201111-15201133 CTTGAGGCCTATGGTTTAAAAGG - Intergenic
1180506795 22:16020091-16020113 CTTGAGGCCTATGGTGGAGAAGG - Intergenic
1180507719 22:16032144-16032166 CTTGAGGCCTATGGTGGAGAAGG - Intergenic
1180507866 22:16034873-16034895 TTGGAGGCCTATGGTTGAAATGG - Intergenic
1180509176 22:16059289-16059311 CTTGAGGCCTATGGTGTAAAGGG - Intergenic
1180509449 22:16064917-16064939 TTTGAGGCCTATGGTTTAAAAGG - Intergenic
1180628510 22:17210669-17210691 CTGGAGGCGGAGGTTGTAGAGGG - Intronic
1181927821 22:26374740-26374762 CTGGAGGCCAAGTTTCTAGAAGG + Intronic
1182395520 22:30033284-30033306 GTGGAGGCCTTGCGTTCAGATGG + Intergenic
1183983335 22:41555429-41555451 CTGGAGGCCTATGGCCCAGAGGG + Intergenic
1184765330 22:46569268-46569290 CTGCAGGCCCAGGGGTTTGAGGG + Intergenic
1185379637 22:50502534-50502556 CTGGAGGCCCTGGGTTGGGACGG - Intergenic
1203331860 22_KI270739v1_random:1677-1699 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
1203335714 22_KI270739v1_random:69882-69904 CTTGAGGCCTAGGGTGAAAATGG + Intergenic
958207769 3:90426563-90426585 TTGGAGGCCTAGGGTAGAAAAGG - Intergenic
958221748 3:90694873-90694895 CTTGAGGCCTACGGTTGAAAAGG - Intergenic
958223346 3:90776147-90776169 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958225316 3:90809276-90809298 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958227032 3:90838162-90838184 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958228680 3:90866197-90866219 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958228782 3:90867897-90867919 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958228887 3:90869596-90869618 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958230692 3:90900178-90900200 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958231306 3:90910373-90910395 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958231403 3:90912072-90912094 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958234269 3:90959646-90959668 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958234861 3:90969839-90969861 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958234961 3:90971538-90971560 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958235751 3:90985130-90985152 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958236062 3:90990227-90990249 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958237883 3:91020813-91020835 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958238783 3:91036099-91036121 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958239401 3:91046294-91046316 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958240397 3:91063281-91063303 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958240802 3:91070074-91070096 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958241632 3:91083670-91083692 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958242287 3:91094719-91094741 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958244211 3:91127002-91127024 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958245626 3:91150791-91150813 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958246639 3:91167784-91167806 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958247550 3:91183077-91183099 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958247852 3:91188174-91188196 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958248061 3:91191571-91191593 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
958249576 3:91217057-91217079 CTTGAGGCCTATGGTGGAGAAGG + Intergenic
961961934 3:130864579-130864601 CTGGAGGCCTGTGGTTTCGTGGG + Intronic
962209106 3:133461572-133461594 CTGGAGGCACAGGGTTGAAATGG + Intronic
962257358 3:133881531-133881553 CTGGAGGCCCAGCTTCTAGAAGG + Intronic
964646021 3:158959354-158959376 CAGAAGACCTAGAGTTTAGAAGG - Intergenic
969722402 4:8899680-8899702 CTGAAAGCCTAGGGTTGATAGGG + Intergenic
969922376 4:10552519-10552541 GTGGAGGCATTGGGTTTAGGTGG - Intronic
970100943 4:12521810-12521832 CTTGAGGCCCAGGGTTGAGCTGG - Intergenic
972128291 4:35798542-35798564 CTGGTGGTCTATGGGTTAGAAGG + Intergenic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
980438263 4:132809343-132809365 CTTAAGGTCTCGGGTTTAGATGG - Intergenic
981168262 4:141588778-141588800 CTGGAGCCTCAGGGTTTAGAAGG - Intergenic
989834429 5:45968071-45968093 CAGGAGGCCTATGGTGTAAAAGG + Intergenic
989859207 5:46344807-46344829 CTTGAGGCCTATGGTGTAAAAGG - Intergenic
989943124 5:50178839-50178861 TTTGAGGCCTATGGTTTAAAAGG - Intergenic
997329963 5:133052649-133052671 CTGCAGGCCTAGGATGTAAACGG + Intronic
997736856 5:136219259-136219281 CTGTAGACCTAGGGCTCAGAGGG + Intronic
1008700342 6:54091745-54091767 CTGGAGGCCTAGGGTTTAGAAGG - Intronic
1009157047 6:60230563-60230585 TTTGAGGCCTATGGTTTAAAAGG + Intergenic
1010890137 6:81297605-81297627 CTAGAGCCCAAGGGTATAGAAGG - Intergenic
1015374511 6:132494348-132494370 CTGGGGGCCAAGGTTTTAGTAGG + Intronic
1015898089 6:138036243-138036265 CTGGAGGCCTAGGAGTATGACGG - Intergenic
1016914063 6:149228399-149228421 CTGGTGGCCGAGGGTTCTGACGG - Intronic
1017353942 6:153480052-153480074 CTGGGGGCCTGGGGTTTATAAGG - Intergenic
1019514727 7:1434665-1434687 CTGGAGGCCTAGGGGACAGGTGG + Exonic
1019782227 7:2948435-2948457 CTGGAGGAGCAGGGATTAGAGGG - Intronic
1022481896 7:30749707-30749729 CTGGAGGCCTTGCGTTAGGAGGG + Intronic
1022822767 7:33977376-33977398 CTGGAGGCATGGAGTTTAGGAGG + Intronic
1024896236 7:54265455-54265477 CTGGAAGCTGAGGGTTAAGAAGG + Intergenic
1025569403 7:62539745-62539767 TTTGAGGCCTAAGGTTTAAAAGG + Intergenic
1025569563 7:62542820-62542842 TTGGAGGCCTATGGTTTAAAAGG + Intergenic
1025578992 7:62686571-62686593 ATGGAGGCCAAGGGTTAAAAAGG + Intergenic
1025588379 7:62822448-62822470 CTTGAGGCCTAGGGTGAAAAAGG + Intergenic
1025588660 7:62826539-62826561 CTAGAGGCCTAGGGTGAAAAAGG + Intergenic
1025590116 7:62848363-62848385 ATGGAGGCCTATGGTTAAAAAGG + Intergenic
1025599779 7:62981660-62981682 ATGGAGGTCTATGGTTAAGAAGG + Intergenic
1026994596 7:74607050-74607072 CTGGAGGCCTGGGCTTTGGGAGG + Intergenic
1029318571 7:99736746-99736768 CTGGAGGCTTAGGGGCCAGAGGG - Intergenic
1029323500 7:99785732-99785754 CTGGAGGCTTAGGGGCCAGAGGG - Intergenic
1030009911 7:105155606-105155628 CAGCAGCCCTAGGGTTGAGATGG + Intronic
1032121541 7:129160492-129160514 CTGGAGGCCTGGGGGCTAGGGGG + Intronic
1032473050 7:132192220-132192242 CAGGAGGCCTACAGTCTAGAAGG - Intronic
1032547830 7:132758322-132758344 CTGGAGCCCTAGGGTTTCCTCGG + Intergenic
1032954710 7:136957157-136957179 CAGGAGGCCAAGGATTTGGATGG + Intronic
1034447452 7:151120901-151120923 CTGGAGGATTAGGGTTTGGATGG - Intronic
1037944078 8:22975499-22975521 CTGGAGGCCTGAGGCTGAGAAGG + Intronic
1039211742 8:35224451-35224473 CTTGGGGCCCTGGGTTTAGATGG - Intergenic
1039356254 8:36819940-36819962 CTTCAGGCCTAGCGTTTAGGAGG + Intronic
1042331727 8:67587597-67587619 CAGCAGGCCCAGGGTTAAGAGGG + Intronic
1043561610 8:81500097-81500119 CTGGAGGCCTAGGGTCAAGCAGG + Intergenic
1046226376 8:111285748-111285770 CTGGAGGCCTAGGGGTAAAAAGG - Intergenic
1046262423 8:111786489-111786511 TAGGAGGCCTGGGGGTTAGATGG + Intergenic
1048248048 8:132830948-132830970 CTGGAGGCCGAGAGCTAAGACGG - Intronic
1048284455 8:133130940-133130962 CAGGAGGCCCAGGGTTAATAGGG - Intronic
1048614445 8:136058712-136058734 CTGGAGTCCCAGGGATTTGAGGG - Intergenic
1048876430 8:138839991-138840013 TTGGAGGCATAGGTCTTAGATGG - Intronic
1050008243 9:1157600-1157622 TTGGATGCCTAAGGTTTTGAAGG - Intergenic
1050164138 9:2746772-2746794 CTGGGGACCTCTGGTTTAGAGGG - Intronic
1052923914 9:33997443-33997465 CAGGAGGCCTGGGTTCTAGATGG - Intronic
1053049184 9:34944569-34944591 CTGCAGTCTTAGGGTTCAGAGGG + Intergenic
1053686939 9:40539651-40539673 TTTGAGGCCTATGGTTTAAAAGG + Intergenic
1053687059 9:40541863-40541885 CTTGAGGCCTATGGTTTAAAAGG + Intergenic
1053937107 9:43170578-43170600 TTTGAGGCCTATGGTTTAAAAGG + Intergenic
1053937198 9:43172276-43172298 CTTGAGGCCTATGGTTTAAAAGG + Intergenic
1053937703 9:43182808-43182830 CTTGAGGCCTATGGTGTAAAAGG + Intergenic
1054276689 9:63084335-63084357 CTTGAGGCCTATGGTTTAAAAGG - Intergenic
1054276783 9:63086035-63086057 TTTGAGGCCTATGGTTTAAAAGG - Intergenic
1054398054 9:64678895-64678917 TTTGAGGCCTATGGTTTAAAAGG + Intergenic
1054398146 9:64680596-64680618 CTTGAGGCCTATGGTTTAAAAGG + Intergenic
1059137757 9:111823294-111823316 CTGTAGGCCTAAGGTTTACAAGG + Intergenic
1203353163 Un_KI270442v1:99883-99905 CTTGAGGCCTAAGGTGTAAAAGG + Intergenic
1186147936 X:6644306-6644328 CTGAAGGCTTAGAGGTTAGAGGG - Intergenic
1191569464 X:62591470-62591492 TTTGAGGCCTATGGTTTAAAAGG + Intergenic
1191570647 X:62612838-62612860 TTGGAGGCCTAAGGTGGAGAAGG + Intergenic
1191571532 X:62629823-62629845 TTGGAGGCCTATGGTGGAGAAGG + Intergenic
1191572552 X:62648331-62648353 TTTGAGGCCTATGGTTTAAAAGG + Intergenic
1193305869 X:79950250-79950272 GTAGAGTCCTAGGGTTTTGAGGG + Intergenic
1193649056 X:84108648-84108670 CTGGAGGCCTAGGGGATTCAAGG - Intronic
1193726171 X:85041706-85041728 CTGGAGGCCTTGGGAATAGAGGG + Intronic
1194558688 X:95394140-95394162 CTGGAGCCCTAGGGTTTTGATGG + Intergenic
1194988146 X:100513488-100513510 CTAGAGGCCTAAGGTAGAGAGGG + Intergenic
1195002959 X:100659854-100659876 CTGTTGGCCTAGGGTTGGGAAGG - Intronic
1198750658 X:139933417-139933439 CTGGGGGCCGAGGGTGTAGAGGG - Intronic
1200230568 X:154441927-154441949 TTGGAGCCCTAGGGTTTGGGTGG + Intronic
1201311068 Y:12598512-12598534 CTGGAGGCCTAGAGGCCAGAGGG + Intergenic