ID: 1008702326

View in Genome Browser
Species Human (GRCh38)
Location 6:54116005-54116027
Sequence AGGTTTTGAGAGTTGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008702322_1008702326 -3 Left 1008702322 6:54115985-54116007 CCAGAAGGTATACAGTGAAAAGG 0: 1
1: 0
2: 1
3: 14
4: 209
Right 1008702326 6:54116005-54116027 AGGTTTTGAGAGTTGGAGCAGGG 0: 1
1: 0
2: 1
3: 16
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008702326 Original CRISPR AGGTTTTGAGAGTTGGAGCA GGG Intronic
900486027 1:2923197-2923219 GGGTCCTGAGAGATGGAGCACGG - Intergenic
901753413 1:11426235-11426257 AGGTAGTGAGAGTTGGGGGAGGG - Intergenic
903250349 1:22048861-22048883 ATGGATTGAGAGTTGGGGCAGGG + Intergenic
903321188 1:22544101-22544123 AGGTATTAGGAGGTGGAGCAGGG + Intergenic
904701471 1:32361048-32361070 AGGGTTAGAGAGATGGACCAGGG + Intronic
907941364 1:59090958-59090980 AGAATTTGAAAGTTGGAGAATGG + Intergenic
910028496 1:82687560-82687582 GGGTTTTAAGAGTTGGATCTTGG + Intergenic
912046732 1:105468563-105468585 AGATTTGGAGAGTTTGAGCAAGG - Intergenic
912727017 1:112067616-112067638 AGTATTTGAGAGTGGGAGGAGGG - Intergenic
912839598 1:113027321-113027343 AGGTTTTGAAAGTGGGATGAGGG + Intergenic
914228388 1:145741797-145741819 AGATTTTAAGAGAAGGAGCAGGG - Exonic
915107955 1:153546059-153546081 AGTTTTAGAGAGGTGGAGGAAGG + Intronic
916203988 1:162297840-162297862 AGATTTTGAGAGGTGGAGAGAGG + Intronic
917237926 1:172914686-172914708 AGGTGTTCAGAGGTGGAGCGGGG + Intergenic
918254849 1:182739950-182739972 GGGTGTTGGGAGCTGGAGCATGG - Intergenic
918290488 1:183102770-183102792 AGTGTTTGAGAGATGTAGCAGGG - Intronic
919412523 1:197264117-197264139 AGGTTGAGGGAGTTGGAGGAGGG - Intergenic
920303847 1:205006417-205006439 AGATGGTGTGAGTTGGAGCAAGG + Intronic
924615220 1:245606759-245606781 AGGTTTTGAAAAGAGGAGCATGG + Intronic
1063666736 10:8065651-8065673 AGGTTGAGAAAGTTGGAGAAGGG - Intronic
1065572768 10:27088909-27088931 AGGTTTTGAGTGTAGGTGGAAGG + Intronic
1066289888 10:34004270-34004292 AGGGTTTTGGAGTTGGAGGAAGG - Intergenic
1066291036 10:34014639-34014661 AGTTTTTGAGGGGTGGGGCAGGG - Intergenic
1066603425 10:37134707-37134729 AGGTTTTGAGTGGAGGAGCAGGG - Intronic
1071370958 10:84951310-84951332 ATGTTCTGGGAGTTGGAGAAAGG - Intergenic
1072223165 10:93344910-93344932 AGGATTTGGGGGTTAGAGCATGG + Intronic
1073596832 10:104809081-104809103 AGGTTTTGGGAGGTAGAACATGG + Intronic
1075426971 10:122349564-122349586 AGGTTCTGGGGATTGGAGCAAGG - Intergenic
1078537800 11:12189060-12189082 AGGTTCTCAGAGTGGGAGAATGG - Intronic
1079626409 11:22622061-22622083 AAGTTTTGAGAGTAAAAGCATGG + Intergenic
1081732202 11:45379522-45379544 TGGTTCTGAGAGCTGGAGTAAGG - Intergenic
1082658886 11:55885768-55885790 TGCTCCTGAGAGTTGGAGCACGG - Exonic
1083875273 11:65520106-65520128 AGGTTCTGAGAGTTAGGACATGG + Intergenic
1085065011 11:73487168-73487190 GAGTGATGAGAGTTGGAGCATGG - Intronic
1087663902 11:101019920-101019942 TGAGTGTGAGAGTTGGAGCAAGG - Intergenic
1088534464 11:110845226-110845248 TGGCTTTGAGATTTGGAGCAAGG - Intergenic
1089114976 11:116087490-116087512 AGGCATTGGGGGTTGGAGCAAGG - Intergenic
1089907917 11:122064241-122064263 AGTTTTTGTGAGGTGGAGGAAGG + Intergenic
1090063572 11:123484666-123484688 AGGTTTTGGGGGTTGGAGGGGGG - Intergenic
1095658656 12:44701875-44701897 AGGATTTCAGAGTTGCATCAAGG - Intronic
1097803777 12:63943650-63943672 AGTTTTTGAGGGTTGGAGGTGGG + Intronic
1098811719 12:75102975-75102997 AGGTTTTCACAGTAGGAGAAAGG + Intronic
1099103557 12:78473271-78473293 AGATTTTGAAGGTAGGAGCAGGG - Intergenic
1100812894 12:98357264-98357286 AGGTGTTGAGTGTTGGACAATGG - Intergenic
1101695991 12:107127363-107127385 GGGTTTTGTTAGTTGAAGCATGG + Intergenic
1103017678 12:117508486-117508508 AGGGTTGGAGAGTGGGAACATGG + Intronic
1104234356 12:126918616-126918638 GGTTTTTAAGAGTTGGAGCGTGG - Intergenic
1105982555 13:25533795-25533817 AGGTTTAGAGGGTTGAAGAATGG + Intronic
1106485267 13:30166885-30166907 AGGTCTGGGGAATTGGAGCAAGG - Intergenic
1107038602 13:35925910-35925932 AGGTCTTGAGATTTCAAGCATGG - Intronic
1107146673 13:37067783-37067805 AGGTTTTAAGAGCTGGAGTAGGG - Intergenic
1107191218 13:37588976-37588998 AGTTTTTAAGAATTGGAGAAAGG + Intronic
1109936576 13:69293563-69293585 AGATTATGAGATATGGAGCAGGG - Intergenic
1110065873 13:71104614-71104636 AGGTGCTGAAAGTTGGAACAGGG - Intergenic
1111961329 13:94814026-94814048 CGGTTTTGAAAGCTGGTGCACGG - Intergenic
1114353528 14:21881533-21881555 GGGTTTTGAGTCTGGGAGCAAGG - Intergenic
1114750657 14:25201124-25201146 TGAGTTTGAGAGTTGGAGAAGGG - Intergenic
1114894460 14:26969778-26969800 AGGCTTTGAGAGAGTGAGCATGG + Intergenic
1114895483 14:26984772-26984794 AGGGTCTTAGAGTTGGGGCATGG - Intergenic
1115302956 14:31904521-31904543 AGGATTTCAGAGCTAGAGCAGGG - Intergenic
1115594752 14:34898648-34898670 AGGTTGTTAGAGAAGGAGCACGG + Intergenic
1116919985 14:50561667-50561689 AGGCATGGAGAGTTGGAGCGGGG + Intronic
1117190095 14:53280888-53280910 AGGTTTTGAAAATTGGGGAAAGG + Intergenic
1118040360 14:61909660-61909682 AGGTTATGAGTGTTAGGGCATGG + Intergenic
1118623146 14:67632517-67632539 TGGTTTTGCAAATTGGAGCAAGG + Intronic
1119508851 14:75195767-75195789 AGGTTTAGGGAGTTGGTTCAAGG - Intergenic
1119952198 14:78756633-78756655 AATTTTTAAAAGTTGGAGCAAGG - Intronic
1120655255 14:87181510-87181532 AAGCTTTGAAAGATGGAGCACGG - Intergenic
1122569200 14:102683447-102683469 AGAATTGGAGAGGTGGAGCACGG + Intronic
1122773437 14:104107057-104107079 AGGCTTTGAGGGTGGGCGCAGGG + Intronic
1128210069 15:65892352-65892374 AGATTTTGTGGTTTGGAGCAAGG - Intergenic
1129077078 15:73006104-73006126 AGGTGTTGAGAGTCCGAGCTAGG + Intergenic
1130181480 15:81633767-81633789 AGGTTCTGAGAATTAGGGCATGG - Intergenic
1130605896 15:85316417-85316439 AGGTTTTGGAACTTGGAACACGG - Intergenic
1130921173 15:88345945-88345967 ATTTTTAGAGAGTTTGAGCAAGG - Intergenic
1130932684 15:88441080-88441102 AGCTGGTGAGTGTTGGAGCAGGG + Intergenic
1131937563 15:97523186-97523208 AGGTTCAGAGAGTTGGAGTAGGG - Intergenic
1132952266 16:2569922-2569944 AGGTGGTGGGAGATGGAGCAGGG + Intronic
1132962085 16:2630248-2630270 AGGTGGTGGGAGATGGAGCAGGG - Intergenic
1133316819 16:4890080-4890102 AGCCTTTGGGAGGTGGAGCAGGG - Intronic
1138054082 16:53814114-53814136 AGGTGTTTTGAATTGGAGCATGG - Intronic
1138984696 16:62314260-62314282 AGGTTTACAGAGATGGAGCCAGG + Intergenic
1139613642 16:68076031-68076053 AGGTGTGGAGAGGGGGAGCAGGG + Intronic
1140028162 16:71311009-71311031 AGGTTTAAAGAGATGGAGGAAGG + Intergenic
1140229930 16:73109077-73109099 AGGACTTGAGAGATGGAGCTGGG + Intergenic
1141652690 16:85402014-85402036 AGGTTTTCAGAACTGGAGCCCGG + Intergenic
1143039465 17:4022975-4022997 AGCTTTTGGAAGTTAGAGCAGGG - Intronic
1144207871 17:12991961-12991983 AGGTTTTGAGAAATGGCACACGG - Intergenic
1144311222 17:14015977-14015999 ATGTTTTTAGAGTTGCAGGAAGG - Intergenic
1146725393 17:35151644-35151666 AGTTATTGAGTCTTGGAGCAAGG - Intronic
1149630363 17:58116817-58116839 AGGTCTGGGGAGATGGAGCATGG - Intergenic
1149920027 17:60649211-60649233 ATGTTTTGAGATTAGGAGCTGGG - Intronic
1150152141 17:62818769-62818791 AGGTTGTGAGAGTTGGAGTCAGG + Intergenic
1150315732 17:64167158-64167180 AGGTTGTGTGTGTTGGAACAGGG + Intronic
1150669986 17:67185608-67185630 AGATTTTGAAAGTTGGGGAAAGG - Intronic
1152082971 17:78199903-78199925 AGGATGGGAGAGGTGGAGCATGG + Intronic
1153505942 18:5798060-5798082 AGGGTTTGAGTGATGGAGCATGG - Intergenic
1156259161 18:35428625-35428647 GGGTTCTGACAGTTGGAGGAGGG - Intergenic
1156808143 18:41212403-41212425 GGGTTTTGAGAGTTAAAACAAGG - Intergenic
1157475262 18:48019996-48020018 AAGTGTAGAGAGTTGGAGAAGGG + Intergenic
1159039299 18:63308359-63308381 AGGTTCTCACAGTGGGAGCAAGG - Intronic
1160538226 18:79606742-79606764 TGGTTTTGAGGATTGGAGCCAGG + Intergenic
1163593099 19:18205147-18205169 AGGGTTTGAAAGCTGGAGTAGGG - Intergenic
1163719315 19:18891136-18891158 AAGTTATGAGAGTTCGATCATGG + Intronic
1163815568 19:19462709-19462731 AGGTTCTGAGAGATGCAGGATGG - Intronic
1166352745 19:42207829-42207851 AGGCTTTGTGGGTGGGAGCAGGG - Intronic
1166581570 19:43904881-43904903 AGCTTTTGAGATTTGTTGCATGG - Intergenic
1168463278 19:56580254-56580276 ATGCTTTGAGTGTTGGAGGAAGG + Exonic
925176692 2:1789759-1789781 GCGTTTTGAGAGCTGAAGCAAGG - Intronic
927092080 2:19719787-19719809 AGGTTTGGAGAGTTAGCTCAAGG + Intergenic
928959313 2:36907158-36907180 AGTTTTTTAGAGTTTGATCAAGG - Intronic
931694494 2:64861476-64861498 AGATTTTGTGTGCTGGAGCATGG - Intergenic
934037685 2:88102334-88102356 AGGTTTTGATATTTGAGGCAAGG - Intronic
934987119 2:98895560-98895582 AAGTTTTGAGAGCTGGATTAGGG + Intronic
935215182 2:100970280-100970302 AGGATTTGAGAGGTGGAGGATGG - Intronic
935417414 2:102833539-102833561 TAGTTTTGAGAGTTGAACCATGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937659666 2:124416194-124416216 AAGTATTGAGAGTTGGAGTGAGG + Intronic
938915335 2:135933073-135933095 AGGCTTTGAGGGGTGGAGGAGGG - Intronic
940189669 2:151027164-151027186 TAATTCTGAGAGTTGGAGCAGGG + Intronic
945411871 2:209519413-209519435 AAGTTTTGCAACTTGGAGCAAGG + Intronic
947357970 2:229316528-229316550 AGGTTATGATAGCTAGAGCAGGG + Intergenic
1169251148 20:4062401-4062423 TGATTTTGAGAGGTGGAGGAAGG + Intergenic
1169661056 20:7978926-7978948 ATGTTTGGGGAGTTGGAGCAGGG - Exonic
1169676379 20:8159384-8159406 TGGTTTTGTGGGTTGGAACAAGG - Intronic
1170907218 20:20527422-20527444 AGTGTTTGAGAGATGGAACAAGG - Intronic
1171034313 20:21703890-21703912 AGGGTGCGAGAGTGGGAGCAGGG - Intergenic
1171357402 20:24559291-24559313 AGGGTGAGAGAGTGGGAGCAGGG + Intronic
1172873747 20:38151759-38151781 AGTTTTAGAGAGTTGGAACCTGG + Intronic
1173118105 20:40265280-40265302 ATGTTTTGAGAGCAGGAGCTTGG + Intergenic
1174101064 20:48126499-48126521 AGGGTTTTAGAGCTGGAGCCTGG - Intergenic
1174193868 20:48758991-48759013 GGCTTCTGAGAGTTGGGGCATGG - Intronic
1175645237 20:60665097-60665119 AGGATCTGAGAGTTGGGGCGAGG + Intergenic
1175935021 20:62510341-62510363 AGGGTTGGAGAGGTGGAGGATGG - Intergenic
1177006975 21:15685818-15685840 AGGTTCTGAGGATTTGAGCATGG + Intergenic
1177068864 21:16476356-16476378 ATGATTTGAGAGTTCGAGCCAGG - Intergenic
1178149517 21:29777907-29777929 AGGTTTAGAGAGCTAGAGGATGG + Intronic
1179400808 21:41081292-41081314 TGGTTGGGAGAGATGGAGCATGG - Intergenic
1181845488 22:25705210-25705232 AACTTTTGAGAGGTGGAGGAAGG - Intronic
1182115119 22:27751962-27751984 TGGCTTTGAGAGTGGGGGCATGG + Intronic
1182752032 22:32649546-32649568 ATGTTCTGGGAGTTGGAACAGGG - Intronic
1183268186 22:36843942-36843964 AGGCTTTGGGAGTTGCCGCAAGG + Intergenic
1184108532 22:42382420-42382442 AGGCTGTGGGAGGTGGAGCAGGG + Exonic
1185421065 22:50734650-50734672 AGGGTCTGAGTGTGGGAGCAGGG - Intergenic
951017051 3:17742701-17742723 AGGTTATTAGAGGTGGAGCGCGG - Intronic
951744578 3:25962857-25962879 AGGATTTGGGACTTGGAGAAAGG + Intergenic
952930829 3:38360007-38360029 AGGTTTGGAGAGGTAGAGGAGGG - Intronic
953076477 3:39575472-39575494 AGGTTGTGATAGTTGGAAAATGG + Intergenic
954888147 3:53895318-53895340 AGGGCTTGAGAGTTGGAGAGGGG + Intergenic
956004260 3:64762066-64762088 ATATTTTGAGAGGTGGAGGAGGG - Intergenic
957931939 3:86891137-86891159 AGGCTTTGGGAGTAGGAGCAAGG - Intergenic
959827995 3:110823386-110823408 AGGTTTTGAGGGCTGGGGAACGG + Intergenic
961024228 3:123539173-123539195 AGGTTTTGAGAGTAAAGGCAAGG - Intronic
961154836 3:124670879-124670901 AGGTTTGGAGACTCGGAGGATGG - Intronic
963853125 3:150227312-150227334 AGGCTTAGAGAGGTGAAGCAAGG - Intergenic
964037964 3:152221654-152221676 AAGTTTTGAGAGTTGAGGGAAGG - Intergenic
964069391 3:152613304-152613326 AGAGGTTGAGAGTTGAAGCAAGG - Intergenic
965498977 3:169434017-169434039 ACGTTTTGACACTTGGAGAATGG - Intronic
967271476 3:187736954-187736976 TGGTTTTGAGATTTTGGGCAAGG - Intronic
968003755 3:195225403-195225425 AGGAGTTGAGAGTTGAAGCTCGG - Intronic
969174012 4:5385433-5385455 AGGTTGTGAGTGTTGGAGGGAGG + Intronic
970825186 4:20263682-20263704 AAGTTTTGAAAGATGAAGCAAGG - Intronic
972706437 4:41548720-41548742 GGGATTTGGGAGTTGGAACAAGG - Intronic
975469241 4:74746162-74746184 AGATTTAGAGAGTTGGAGATTGG - Exonic
977133640 4:93273480-93273502 AGGTTTGGAGGATTGGGGCATGG - Intronic
980140310 4:128907817-128907839 TGGTTATGAGAGTATGAGCAAGG + Intronic
982385787 4:154800610-154800632 AGGTTTTGGGGGGTGGAGGAGGG - Intronic
984206778 4:176794555-176794577 ATGTTTTGTGATTTGGAACATGG + Intergenic
984652504 4:182285807-182285829 ATGTTTTCAGAGATGGACCAAGG + Intronic
985324624 4:188754245-188754267 AGATTATGAGAGTGGGAGCCTGG - Intergenic
986789453 5:11145650-11145672 AGGATTAGAGAGGTGGGGCAGGG - Intronic
986908200 5:12520612-12520634 AGGTGGTGAGAGTGGGAGCAAGG - Intergenic
988247155 5:28701313-28701335 AGGAGTTGAGAGTAGGAGGAGGG + Intergenic
988798406 5:34673859-34673881 GGGTTTTTAGAGTTGGGGGAGGG - Intronic
991556694 5:67902673-67902695 AAGTTTAGAGACTTGGAGGAGGG - Intergenic
991624316 5:68583657-68583679 AGTTTGTGATAATTGGAGCAGGG - Intergenic
991639080 5:68735799-68735821 AGGTTTTGGGTGTTGGAGGGAGG + Intergenic
992895926 5:81245174-81245196 AGGCTTTGACAGCTGGGGCAGGG + Intronic
994191090 5:96870111-96870133 AGCTTTTGATAGTAGGACCAGGG + Intronic
994910047 5:105892752-105892774 AGATGTTAATAGTTGGAGCAGGG + Intergenic
996220312 5:120924140-120924162 GGGTTATCAGAGTTGCAGCAGGG - Intergenic
997659383 5:135578098-135578120 AGGTTTTCTGAGTTGGCACAAGG + Intronic
998640775 5:144008174-144008196 AGGTTATGTGACTTGGATCATGG + Intergenic
999013704 5:148072404-148072426 ATGTTTTTAGAGTCGGATCATGG - Intronic
1001781880 5:174375835-174375857 AGGATTTAAGGGTTGGTGCATGG - Intergenic
1003201032 6:3960621-3960643 ACGGTTTGAGAGCTGGAACAAGG + Intergenic
1004500991 6:16209951-16209973 AGGTTCTGTGAGCTGGGGCAGGG - Intergenic
1006204920 6:32332132-32332154 AGGCTTTGAGAGGTAGAGCAGGG + Intronic
1006561276 6:34914831-34914853 AGGCTCTGAGTGTGGGAGCAGGG + Intronic
1008095799 6:47338091-47338113 AGGGTTTGAGACTGGGAGTAGGG + Intergenic
1008253415 6:49268194-49268216 AGCGTTGGAGAGTTGGAGGAAGG + Intergenic
1008702326 6:54116005-54116027 AGGTTTTGAGAGTTGGAGCAGGG + Intronic
1009324171 6:62329494-62329516 ATGTTTTGAGAGTAGGAGAATGG - Intergenic
1009868401 6:69426698-69426720 AGGTTTTGATAGATGGTGCGAGG - Intergenic
1014837909 6:126181538-126181560 GGGTTTTGTGGGTTGGACCAAGG + Intergenic
1014901686 6:126973315-126973337 AGGTTTTAAGAAATGGAGAATGG + Intergenic
1015515146 6:134075891-134075913 AGATTTTGAGAGTCAGAGCAGGG - Intergenic
1015622762 6:135149594-135149616 AGGTTTTGGGGGTGGGGGCATGG - Intergenic
1016201795 6:141419092-141419114 AGGCTTTGAGATTTGGAGTGAGG + Intergenic
1016308954 6:142713268-142713290 AGGCTTTGAGGGTTGGAGCATGG - Intergenic
1017147936 6:151251519-151251541 AGATTTTAAGAGTTGGAAGATGG + Intronic
1020371229 7:7433978-7434000 AGTTTTTGAGAGTTGGACTTTGG - Intronic
1020736382 7:11954059-11954081 GAGTTTTAAGAGTTGGAGTAGGG + Intergenic
1021270371 7:18577530-18577552 AGGTTCTGAGAATAGGAGAAAGG - Intronic
1021907370 7:25348677-25348699 AGGTTTTCAGAGTTGGGGGCAGG + Intergenic
1022100038 7:27164101-27164123 GCGTTTTGAGAGTGGGAGGAAGG - Intronic
1022921770 7:35023143-35023165 AGGTTTGGGGACTTGGAGGATGG - Intronic
1023714465 7:43029205-43029227 GGGATTTGAGAGCTGGAGCTTGG + Intergenic
1027815019 7:82957818-82957840 AGCTTTTGTGAGCGGGAGCATGG + Intronic
1028318701 7:89435355-89435377 AGTTTTTAAGAGCTGGAGTAGGG - Intergenic
1028859625 7:95634158-95634180 AAGTCTTGAGACTTAGAGCAGGG + Intergenic
1029945731 7:104531029-104531051 AAGTTCTGAAAGTTGGAACAGGG + Intronic
1030850756 7:114483384-114483406 TGGTTGTGAGATTTTGAGCAAGG - Intronic
1032098287 7:128951207-128951229 ATGTTTTGAGATTAGGAGAAGGG + Intergenic
1033511529 7:142064537-142064559 AGGTTGTGACAGCTGGAGAAGGG - Intronic
1033514591 7:142093565-142093587 AGGTTGTGACAGCTGGAGAAGGG - Intronic
1033601270 7:142890062-142890084 AGGCTTTATGAGTTGGCGCACGG - Intergenic
1033907945 7:146229403-146229425 AGGCTTTGGGAGTTGGGTCATGG - Intronic
1035194912 7:157209878-157209900 AAGTTTTAAGAGTTAGGGCAAGG + Intronic
1038204607 8:25453975-25453997 ACGTTGTTAGAGTTGGAGAAAGG - Intronic
1039355311 8:36808994-36809016 AGGTTTTGAAAGTTGGAAGAGGG - Intronic
1040015097 8:42693221-42693243 AGGTTTTGTGGGAGGGAGCAGGG - Intergenic
1042469066 8:69162284-69162306 AGGTCTTGGCAGTTGCAGCAAGG + Intergenic
1042711908 8:71726649-71726671 ATGTTTTGAGAACTGGAGTAGGG + Intergenic
1045543374 8:103106727-103106749 TGGTTTTGCAACTTGGAGCAAGG - Intergenic
1046024054 8:108700802-108700824 AGGTTTACACAGCTGGAGCATGG + Intronic
1046730855 8:117724736-117724758 AGCTTTTGAGCTTTGGAGGAAGG - Intergenic
1051534943 9:18146544-18146566 AGGTTTTGAGGGAGGGAACAGGG + Intergenic
1052384551 9:27808093-27808115 AGTTTTTAAGAGCTGGAGTAGGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1056541538 9:87575636-87575658 AGATTTTGAGAGCTAGTGCAGGG + Intronic
1057153735 9:92820235-92820257 AGGTTTTTAGTGTTGGGGAAAGG - Intergenic
1058567721 9:106304360-106304382 AGGTTCTGAGAGCTGGAACAAGG + Intergenic
1058807737 9:108608603-108608625 AGGATGTGATAGTTGGAGGAGGG - Intergenic
1059146253 9:111902610-111902632 AAGCTTTGTGACTTGGAGCAGGG + Intronic
1060018776 9:120110536-120110558 AGCTTTTAAGTGTTGGAGCTAGG - Intergenic
1061535898 9:131250114-131250136 AAGTCTTAAGAGTAGGAGCAGGG - Intergenic
1185431268 X:13441-13463 TGGTTTTCAGGGATGGAGCATGG - Intergenic
1185432122 X:17476-17498 TGGTTTTCAGGGGTGGAGCATGG - Intergenic
1185440535 X:225838-225860 TGGTTTTCAGGGATGGAGCATGG - Intergenic
1185441438 X:230190-230212 TGGTTTTCAGGGGTGGAGCATGG - Intergenic
1187567080 X:20461465-20461487 GGTTTTTGAGATTTGGAGTAAGG + Intergenic
1188171760 X:26936369-26936391 AGGTTTTGAGGGTTATGGCAGGG + Intergenic
1189324261 X:40103462-40103484 AGCTTTTGAGAGATGAAGGAGGG + Intronic
1190399181 X:50014595-50014617 AGGATTAGAGAGGGGGAGCAGGG - Intronic
1191060306 X:56288435-56288457 AGTTTTTGAAAGTAGGACCACGG + Intergenic
1191637819 X:63396810-63396832 AGGGTTTCAGACTTGAAGCATGG + Intergenic
1192873490 X:75206465-75206487 AGTTTTTAAGAGCTGGAGTAGGG + Intergenic
1195699060 X:107688732-107688754 AGGGTATGAGAGTGGAAGCAGGG + Intergenic
1198446788 X:136725286-136725308 AAGTTTTGAGAGTGGCAGAATGG + Intronic