ID: 1008705775

View in Genome Browser
Species Human (GRCh38)
Location 6:54157353-54157375
Sequence CTGCAGGAGCAGAGTGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 618
Summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 551}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008705775_1008705782 22 Left 1008705775 6:54157353-54157375 CCCTCTTCACTCTGCTCCTGCAG 0: 1
1: 0
2: 5
3: 61
4: 551
Right 1008705782 6:54157398-54157420 CCCTCCTTATCCAACTGACCAGG 0: 1
1: 0
2: 2
3: 8
4: 113
1008705775_1008705784 25 Left 1008705775 6:54157353-54157375 CCCTCTTCACTCTGCTCCTGCAG 0: 1
1: 0
2: 5
3: 61
4: 551
Right 1008705784 6:54157401-54157423 TCCTTATCCAACTGACCAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008705775 Original CRISPR CTGCAGGAGCAGAGTGAAGA GGG (reversed) Intronic
900623227 1:3596726-3596748 CTGTAGGAGCAGGGTGGAGACGG - Intronic
902764825 1:18607123-18607145 CTGCAGGAGCAAAGGGACAAAGG + Intergenic
902999281 1:20253272-20253294 TGGCAGAAGCAGAGTAAAGAGGG + Intergenic
904488805 1:30845369-30845391 ATGCAGGAGCAGTGGGAACACGG - Intergenic
904647394 1:31978069-31978091 CTGCAGGGGCAGATGGGAGATGG + Intergenic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905658009 1:39698501-39698523 CTGGAGGAGCAAAATGCAGATGG + Intronic
905658018 1:39698578-39698600 CTGGAGGAGCAAAATGCAGATGG + Intronic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
907424846 1:54373146-54373168 CTGGAGGGGAAGAGGGAAGAAGG - Intronic
907518666 1:55009140-55009162 CTGGAGGAGCAGAGAGAATGAGG - Exonic
907937645 1:59057199-59057221 TGGGAGGTGCAGAGTGAAGAGGG + Intergenic
909024092 1:70463207-70463229 CTGCTGGAGCTGTGAGAAGAGGG + Intergenic
909456370 1:75854316-75854338 CAGCATAGGCAGAGTGAAGATGG - Intronic
910074479 1:83261222-83261244 TAGCAGGTGCAGAGTCAAGAAGG - Intergenic
910380327 1:86620379-86620401 ATGCAGGAGGGAAGTGAAGACGG - Intergenic
910447558 1:87314075-87314097 CTGCTGGAGCAAAATGAATAAGG - Intergenic
910538162 1:88323620-88323642 CAGGAGGAAGAGAGTGAAGAGGG + Intergenic
910539620 1:88341275-88341297 CTACAGGAGCAAGGTTAAGAAGG + Intergenic
911523986 1:98962521-98962543 ATGCAGGAAAAAAGTGAAGAGGG - Intronic
911779518 1:101858693-101858715 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
912322547 1:108727781-108727803 AAGCAGGAGCAGAGGGAAAATGG - Intronic
912967834 1:114251713-114251735 GGGTAGGAGCAGAGTGATGAGGG - Intergenic
913125525 1:115784148-115784170 CTGAAAGAGCAGAGAGAGGAGGG + Intergenic
914349807 1:146831276-146831298 CTCCAGGAGGAGAGGAAAGAGGG + Intergenic
915287833 1:154864156-154864178 CTGCAGGACCAGGATGCAGAAGG - Intronic
916362323 1:163984512-163984534 TGGCAGGAGCAGAGAGAAGGAGG + Intergenic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
916836939 1:168555442-168555464 GTGCAGGGGCAGAGTGGAGGTGG - Intergenic
917017003 1:170543424-170543446 GGGCAGGAGAAGAGGGAAGAAGG + Intronic
917333105 1:173902773-173902795 CTTCAGGAGGAGAGTTAAGGAGG + Exonic
919579151 1:199349615-199349637 CAGCAGGAAGAGAGTGAAGTGGG - Intergenic
920146082 1:203861950-203861972 CTTCAGGTGCGGAGTGAAAACGG + Intronic
920228272 1:204453663-204453685 CTACAGGAACTGAGGGAAGAAGG + Intronic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921300459 1:213746680-213746702 TAGCAGGAGGAGAGAGAAGATGG + Intergenic
921383120 1:214544925-214544947 GGGGAGGAGCAGAGTGAAGGTGG + Intronic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922224552 1:223634062-223634084 ATCCAGAAGCAGAGTAAAGATGG + Intronic
922464375 1:225836743-225836765 CAGCAGAAGCAGAGAGGAGAAGG + Intronic
922677828 1:227563624-227563646 CTGCAGCAGCAGAGTCACCAGGG - Exonic
923291271 1:232548656-232548678 CTGCAGGAGTAGTGAAAAGAGGG + Intronic
923480329 1:234377640-234377662 CAGAAGGATCAGAGTGAAGCTGG - Intronic
923562164 1:235049574-235049596 CTGCAGGAGCCGTGTGGAGCTGG - Intergenic
923907504 1:238401778-238401800 CAGCCGGAGCAGGGGGAAGAGGG + Intergenic
924089443 1:240487277-240487299 CAGCAGGAGCCGGGAGAAGAAGG + Intergenic
924656586 1:245978093-245978115 TTGTAGGAGCTGAGTGAACATGG + Intronic
924948832 1:248864269-248864291 CTGAATGAGCAGTGTGAGGAGGG - Intergenic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1064506409 10:16035046-16035068 GCTCAAGAGCAGAGTGAAGAGGG + Intergenic
1064709312 10:18107474-18107496 ATGCAAGAGCAGACTGAAGAGGG - Intergenic
1066291922 10:34022295-34022317 TTGCAGCAGCAGAGCAAAGAAGG + Intergenic
1066484849 10:35833447-35833469 CTGCAGCAGCAAAGTGACCAAGG - Intergenic
1066502524 10:36007928-36007950 CTGCAGGAGCAGTGGGCAGTGGG + Intergenic
1066542443 10:36462138-36462160 ATGCAAGATCAGAGTGAAGTAGG - Intergenic
1066628456 10:37434015-37434037 CTGGAGGAGCAGTGTGGGGAGGG + Intergenic
1067130606 10:43561164-43561186 CTGCATGAGGACAGTGAAGATGG + Intronic
1067151263 10:43736915-43736937 CTGCAGGAGCAGAGCACACAGGG - Intergenic
1068143903 10:53040885-53040907 CTCCAGGAGTAGAGTGAGGAGGG + Intergenic
1068199773 10:53767983-53768005 CAGGAGGAACAGAGTGAAGGGGG + Intergenic
1069333258 10:67318588-67318610 TAGCTGGAGCAGAGTGAACATGG - Intronic
1069498912 10:68931851-68931873 CTGCTGGAACAGACTGAAAAGGG - Intronic
1069720117 10:70544494-70544516 AGGCAGGAGCTGAGTGAGGAGGG + Intronic
1070823249 10:79375528-79375550 CTGCAGGAGCTGAGTGTGGAGGG + Intergenic
1070974965 10:80599274-80599296 CTGAAGGAGAAGACAGAAGAAGG + Intronic
1071477849 10:86040087-86040109 CTGAAAAAGCAGAGTTAAGATGG + Intronic
1071801403 10:89066125-89066147 CTGCAGAGGCTCAGTGAAGAGGG - Intergenic
1071945532 10:90639573-90639595 CTCCATTAGCAGAATGAAGAGGG + Intergenic
1072370756 10:94764592-94764614 CTGCTGGAGAGGGGTGAAGAAGG + Intronic
1072737118 10:97886587-97886609 CTGCAGAAGCGGGGTGAAAATGG + Intronic
1073563860 10:104519085-104519107 TGGAAGGAGCAGAGGGAAGAGGG - Intergenic
1073805554 10:107093840-107093862 GAGCTGGAGCAGAGTGAAGGAGG - Intronic
1073994391 10:109299144-109299166 CTGAAGGAACAGAGTGATGTTGG - Intergenic
1075372598 10:121950497-121950519 CTGCAGGAGGAGAGTGTAGGAGG + Intergenic
1075396680 10:122132820-122132842 CTGCAGGAGAAAAGAGAGGAGGG - Intronic
1075613265 10:123870731-123870753 CTGGAGGAGCTCAGTGATGAGGG - Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076169603 10:128308318-128308340 CTGCAGCTGCAGAGTGTACAAGG + Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076442491 10:130489786-130489808 CCGCAGGGGCAGAGTGCATATGG - Intergenic
1078724178 11:13913912-13913934 CTACAGCAACAGAATGAAGAGGG - Intergenic
1079538233 11:21540643-21540665 CTGGAGGAAGAGAGTGAAGGGGG + Intronic
1079685976 11:23360462-23360484 CTGTGGGAACAGAGTGTAGAGGG - Intergenic
1081387757 11:42492288-42492310 CTGAAGGAGTACAGGGAAGACGG - Intergenic
1081552754 11:44129403-44129425 TGGCTGGAGCAGAGTAAAGAAGG - Intronic
1081763577 11:45593762-45593784 CTGCAGGAGAGGAGTGAGCAAGG + Intergenic
1083181531 11:60988915-60988937 CTGGAGGAGGGGAGTGAGGAGGG - Intronic
1086274751 11:85113143-85113165 CAGCAGCAGCAGAGTACAGAAGG + Intronic
1088540760 11:110911273-110911295 CTGCTGGTGCAGAGGGGAGAGGG + Intergenic
1088835128 11:113571449-113571471 CTGCATGAGTAGACTGGAGAAGG + Intergenic
1089048108 11:115521322-115521344 CTGGAGGAGGAGCCTGAAGATGG - Intergenic
1089397042 11:118143074-118143096 GTGCAGAAGCAGAGAGAAAAAGG - Intronic
1089590304 11:119536026-119536048 GAGCAGGAGAAGAGAGAAGAGGG + Intergenic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1089735432 11:120547376-120547398 CTGCACGAGCGGAGTACAGAGGG + Intronic
1089999024 11:122937720-122937742 ACGAAGGAGAAGAGTGAAGAGGG - Intronic
1090320894 11:125842723-125842745 CTGCAGGAGCAAAGGGAACTTGG - Intergenic
1090329632 11:125920850-125920872 CAGCAGGAGCAGAGAGGAGAGGG + Intronic
1090810989 11:130242888-130242910 CTGCAGTAGCAAAGAGGAGAAGG - Intronic
1090940876 11:131387347-131387369 GCGATGGAGCAGAGTGAAGAGGG - Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1092519236 12:9250314-9250336 CAGCTGAAGCAGTGTGAAGAGGG + Intergenic
1092832816 12:12461694-12461716 CAGCAGCAGCAGAGTGGAGGAGG + Intronic
1093235758 12:16606787-16606809 CTGCAGGAGTCGACTGAGGAAGG + Intronic
1093563588 12:20574691-20574713 CTGAAGGATCAGAGAAAAGAAGG - Intronic
1094030589 12:26007479-26007501 CTGCAAGAGCAGAATGAAGAAGG + Intronic
1094188001 12:27665359-27665381 ATAGAGGAGGAGAGTGAAGAAGG + Intronic
1094773889 12:33698952-33698974 CTTCATGACCAGAGTGATGAAGG + Intergenic
1095285729 12:40407952-40407974 CTGCAGGCTGAGGGTGAAGAAGG - Intronic
1095954421 12:47798220-47798242 CTGTAGGGGCAGAGTCAGGAGGG + Intronic
1096230344 12:49893309-49893331 CAGCAGGAGCAGAGTGTGGCAGG - Intronic
1096452512 12:51756186-51756208 CAGCATGAGCAGGGTGACGAGGG - Intronic
1096634919 12:52952096-52952118 CTGCAGGGGCACAGAGAGGAGGG - Intronic
1099163943 12:79278505-79278527 CAGCAAGAGCAGAGCTAAGAGGG + Intronic
1099541817 12:83919616-83919638 CTGCAGTATCAGATTGATGATGG + Intergenic
1100676046 12:96869508-96869530 CTGCAGGAGCTGAGTCGATATGG + Intronic
1100744928 12:97635304-97635326 CTGCAGGAACATAGAGAAGAAGG - Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1101329853 12:103748940-103748962 CTGCAAGAGCAGAGGAGAGAGGG - Intronic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1103615489 12:122149116-122149138 CTGAAGGAAAAGAGTGGAGATGG - Intergenic
1104037983 12:125111519-125111541 ATGCAAGAGCCCAGTGAAGATGG - Intronic
1104270549 12:127278939-127278961 ATGCAGGAGCAGAGAGAATGAGG - Intergenic
1104646231 12:130499570-130499592 GTGCAGGAGTAGAATGAACACGG - Intronic
1104766563 12:131333754-131333776 CCACAGGTGCAGAGTGAGGAGGG + Intergenic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1104979816 12:132568841-132568863 CCCCAGGTGAAGAGTGAAGATGG + Intronic
1105634442 13:22203779-22203801 CTGCAAGAGCATAGAGAATATGG + Intergenic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1106644052 13:31614089-31614111 CTGAACTAGCAGAGTGCAGAAGG - Intergenic
1109620307 13:64895939-64895961 CTGCTGGAGCAGCTAGAAGAAGG + Intergenic
1111755549 13:92390568-92390590 CTGTAGGAGCCCAGTGCAGAGGG - Intronic
1112239357 13:97665669-97665691 CTGGAGAACAAGAGTGAAGAGGG + Intergenic
1112423078 13:99271411-99271433 CAGCTGGAGCAGAGTGATGGGGG + Intronic
1113458737 13:110467169-110467191 ATGCAGGACCAGAGGAAAGATGG - Intronic
1113460018 13:110475688-110475710 CTACAGGAGCAGCGTGCAGCGGG + Intronic
1114558678 14:23576633-23576655 GTGGGAGAGCAGAGTGAAGACGG + Intronic
1115091532 14:29582845-29582867 CTGCAGGAGAGTAGTGGAGAGGG + Intronic
1116144893 14:41052571-41052593 CTGAAGGTGCAGAGTGAAAGTGG - Intergenic
1116767604 14:49091683-49091705 CTGAAGGAGTAGAGGCAAGAAGG - Intergenic
1117873051 14:60220813-60220835 CTACAAGAGCAGAGTGAGGAGGG - Intergenic
1118689771 14:68326955-68326977 TTGAAGGAGCAGAGTGATGTTGG - Intronic
1119002092 14:70891558-70891580 CTGCAGGAGCAGAGAGAAATAGG + Intergenic
1119205498 14:72790943-72790965 CACCAGGAGCAGAGGGAAGAGGG - Intronic
1119364610 14:74080946-74080968 TTGCAGGAGCATAGAGAACAGGG - Intronic
1120689605 14:87577874-87577896 TTGCAGAAGCAGAGAGAAAATGG + Intergenic
1121527906 14:94632336-94632358 AGCCAGGAGCAGAGTGGAGAAGG + Intergenic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1122357836 14:101134637-101134659 GTGCAGGAGCACAGTGAGGTGGG + Intergenic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1122880232 14:104687596-104687618 AGGCCGGAGCAGGGTGAAGAAGG - Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1124182606 15:27490903-27490925 CGGCAAGAGCAGTGTGAAGGGGG - Intronic
1124986864 15:34626875-34626897 ATACAGGAGGAGAGTAAAGATGG + Intergenic
1125204072 15:37131334-37131356 ATGCAGGAAAAGAGGGAAGAGGG + Intergenic
1126109107 15:45165522-45165544 CTACTGGAGCAGGGAGAAGAGGG - Exonic
1126402001 15:48281540-48281562 CTGAAGGAGAAGAGAGAAGAGGG + Intronic
1127028040 15:54829837-54829859 TTGCAGGAGCAAGGTCAAGAAGG - Intergenic
1127157089 15:56139600-56139622 TTTGAGGAGCAGAGAGAAGAAGG - Intronic
1127262590 15:57337113-57337135 CTGGAGGAGCAGCATGAACATGG + Intergenic
1128220540 15:65965253-65965275 CTGGAGGAGGAGAGAGAAAAGGG - Intronic
1128538052 15:68505303-68505325 CTACAGGGACAGGGTGAAGAGGG + Intergenic
1128796468 15:70470120-70470142 ATGCAGGAGCTGAGGGAGGATGG - Intergenic
1128916523 15:71567656-71567678 CTTCAGGAGCTGAGAGAGGAAGG + Intronic
1129227984 15:74180852-74180874 TTGCAGGAGCAGGGAGCAGAAGG + Exonic
1129432346 15:75508935-75508957 CTTCAGGAGGAGACTGATGATGG + Exonic
1129785413 15:78306854-78306876 CCGCAGGAGGGGAGGGAAGAGGG - Intergenic
1130305976 15:82712232-82712254 CTTCAGGAGCAGTGGCAAGATGG - Intergenic
1130573003 15:85065737-85065759 CTTCAGAAGCAGACTGAAAATGG - Intronic
1131312560 15:91304207-91304229 CTGCAGGAGGAGAGAGAGGGGGG + Intergenic
1131548970 15:93339977-93339999 CGTGAGGAGCAGAGTTAAGAGGG - Intergenic
1131863038 15:96674972-96674994 CTGAAGGAACAGAGGGAAGGAGG + Intergenic
1132770380 16:1558908-1558930 CTGCAGGAGCAGTGAGCTGATGG - Intronic
1132771338 16:1565128-1565150 CGGCAGGCGCAGAGTCGAGAGGG + Intronic
1133791644 16:9013579-9013601 GTGCTGGAGCAGAGCGAACACGG + Intergenic
1134752428 16:16636583-16636605 GTGCAGGAGCAGAGTGGGCAAGG - Intergenic
1134781830 16:16905189-16905211 CAGGAGGAAGAGAGTGAAGAGGG - Intergenic
1134809629 16:17156494-17156516 CTGCAGGAGCAAAGTGGGGCTGG - Intronic
1135507987 16:23055613-23055635 CAGCAGGAACAGACTAAAGATGG + Intergenic
1135880519 16:26251259-26251281 CTGAGGGAGCAGAGAAAAGAAGG - Intergenic
1136236077 16:28914480-28914502 CTGGAGGAGCTGAGCGGAGATGG - Exonic
1136296747 16:29308368-29308390 ATGCAGGACCAGTGCGAAGATGG - Intergenic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1136550446 16:30979846-30979868 CTGCAGCAGCAGCGGGAGGAGGG + Exonic
1137362326 16:47829995-47830017 CTCCAGGAGAACACTGAAGAAGG + Intergenic
1137931022 16:52587879-52587901 GTGCATGAACAGAGTGAAGGTGG + Intergenic
1137975878 16:53031581-53031603 CTGCAGGAGAGGAGAGAGGAAGG + Intergenic
1138094647 16:54202313-54202335 CTGTAGGATGAGAGAGAAGAGGG - Intergenic
1138452306 16:57100785-57100807 CTGCAAGAGAAGGGTGAAGGTGG - Intronic
1138577635 16:57918552-57918574 CAGCACGACCAGAGTGAAAAAGG + Intronic
1139172740 16:64650675-64650697 CTGCTGGAGCAGTGAAAAGAGGG - Intergenic
1139192311 16:64879056-64879078 CAGCAGGAACAGAGGGAAAAAGG - Intergenic
1139515549 16:67450452-67450474 CTGCTGGGGCAGAGCGGAGAAGG + Intronic
1139747244 16:69084443-69084465 CTGAAGGAGCAGAGGACAGAAGG - Exonic
1139984229 16:70884255-70884277 CTCCAGGAGGAGAGGAAAGAGGG - Intronic
1140954437 16:79849198-79849220 CTGCAGGACCAGCGGGAAGGTGG - Intergenic
1141003963 16:80334985-80335007 CTTTAGGAGCAGGATGAAGATGG - Intergenic
1141216733 16:82032206-82032228 CTGCAGGAGCAGAGACTAGTGGG - Intergenic
1142099938 16:88265707-88265729 CTGCAGGAGCAGACGGGAGTGGG + Intergenic
1142564017 17:827825-827847 GGGCAGCAGCAGAGGGAAGAGGG + Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1144133305 17:12268438-12268460 TGCCAGAAGCAGAGTGAAGATGG - Intergenic
1144308749 17:13993077-13993099 CTTCCGGGGCAGAGTAAAGAAGG + Intergenic
1144841211 17:18187146-18187168 CTGCAGAAGCACACTGAAGGGGG + Intronic
1145824648 17:27867633-27867655 CTTCAGAAGCAAAATGAAGAAGG - Intronic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1146543774 17:33720266-33720288 CTCCAGAAGCAGAATTAAGAAGG + Intronic
1148353104 17:46955673-46955695 CTGGAGGAGGTGAGTGCAGAAGG - Intronic
1149074625 17:52580655-52580677 CTGCTGGATAGGAGTGAAGAAGG - Intergenic
1149600242 17:57888823-57888845 CTGGAGGGGCAGAGAGATGATGG - Intronic
1150615450 17:66767349-66767371 CTGCTGGTACGGAGTGAAGACGG + Intronic
1150712840 17:67546451-67546473 CTACAGGAGCACAGGGAAGAGGG - Intronic
1151174201 17:72273795-72273817 AGCCAGGAGCAGAGGGAAGAGGG + Intergenic
1151321074 17:73352638-73352660 CTGCAGGAGCACAGAGATGGAGG + Intronic
1152087057 17:78226782-78226804 CTGCAGGAGTACCGAGAAGACGG + Intergenic
1152295503 17:79464879-79464901 CTGCAGAAGCTCAGTGAAGTCGG + Intronic
1152313564 17:79566378-79566400 CTGCAGGACCATGGTGATGAAGG - Intergenic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1154236785 18:12613459-12613481 CTAAAGGAGCAGAGAGAAGAAGG - Intronic
1155724433 18:29062004-29062026 CAGAAAGAGAAGAGTGAAGAAGG - Intergenic
1155807415 18:30189483-30189505 CAGCAGAAGCAGTGTTAAGAGGG - Intergenic
1156618000 18:38810928-38810950 ATTCAGGAGGAGAGTGTAGATGG - Intergenic
1157045706 18:44099876-44099898 CTCCAGCAGCAGCGTGAAAATGG + Intergenic
1157241471 18:46014005-46014027 CTGAAGGAGAGGAGTAAAGAAGG + Intronic
1157298511 18:46462718-46462740 CTGCAGGGTCAGAGTGGAAAGGG + Exonic
1157887652 18:51384246-51384268 CTTCGGGAGCAGGATGAAGAAGG + Intergenic
1157891565 18:51423126-51423148 GAGCAGGAGCAGAGTCCAGAAGG - Intergenic
1158184830 18:54759943-54759965 TTGCAGGAACAAATTGAAGATGG - Intronic
1158964600 18:62611715-62611737 CTGCAGGCGCAGGATTAAGACGG + Intergenic
1159434781 18:68401905-68401927 TTGCTTGAGCAGAGTGAAGAAGG + Intergenic
1159548675 18:69872109-69872131 CTGAAGGAGAGGAGTGCAGATGG + Intronic
1159578163 18:70205382-70205404 GGGCAGGAGCGGCGTGAAGACGG + Intronic
1160965128 19:1744101-1744123 CTGCAGGAGAGGAGTGAATGGGG - Intergenic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161541008 19:4851621-4851643 ATGCAGGAGCGGAGTGGCGAAGG + Intronic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161831020 19:6604478-6604500 CTGCAAGACCAGAATGAAGGTGG - Intergenic
1161857043 19:6772138-6772160 TGGCTGGAGCACAGTGAAGAGGG + Intergenic
1163324581 19:16594993-16595015 CGGCAGGAGCAGAGTTCAGGAGG - Intronic
1163643094 19:18472966-18472988 TAGAAGGAGCAGGGTGAAGATGG + Intronic
1164644987 19:29852201-29852223 CTGCAAGAGCAGGATGAACAGGG + Intergenic
1165166886 19:33863275-33863297 CTGCAGGGGGAGGGTGGAGAGGG + Intergenic
1165333516 19:35154396-35154418 CTGGGGGAGGAGAATGAAGAGGG - Intergenic
1166569642 19:43785301-43785323 CTGGTGAAGGAGAGTGAAGAGGG + Intergenic
1167430121 19:49449373-49449395 CTCCAGGAGCTGAGGGAGGAGGG + Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1168254414 19:55157878-55157900 CTCCAGGATCAGAGGGAGGAGGG - Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925208952 2:2031352-2031374 CTGCCAGAGCAGATTGTAGAAGG + Intronic
925237646 2:2293456-2293478 CTGCAGGAGCAGGGCGTGGAGGG + Intronic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
926681202 2:15665359-15665381 CAGCAGGAACAGAGTGACCAGGG + Intergenic
926914039 2:17876751-17876773 CTGCAGGAGCTGAGGACAGAAGG - Intergenic
927181631 2:20450621-20450643 CTCCAGGAGCAGAGGGGAGAGGG + Intergenic
927263306 2:21116742-21116764 CTGGAGGAGAGGAGTGAGGAGGG + Intergenic
927499648 2:23574161-23574183 TTGGAGGAGGAGAGGGAAGAAGG + Intronic
927604793 2:24477127-24477149 CTGTAGGAGCAGAGTTAGAAAGG - Intergenic
928196515 2:29220277-29220299 TGGCAGGAGCAGAATGAAGGGGG - Intronic
928312319 2:30221144-30221166 CTGGAAGAACAGAGTCAAGAGGG - Intergenic
928407200 2:31023801-31023823 CTGGAGGAGGAGAGTGATGAGGG - Intronic
929826588 2:45313668-45313690 AGGCAGGAGCAGAGTAAACAAGG + Intergenic
930676742 2:54209752-54209774 TGGCAGGAATAGAGTGAAGATGG - Intronic
931219483 2:60276439-60276461 CTGGAGGAGCAAAATGGAGATGG - Intergenic
932448383 2:71794466-71794488 CTGCAGGGCCAGAGTGGGGAGGG + Intergenic
932610086 2:73192299-73192321 CTGCAAAAGGAGAGTGAAAAAGG + Intergenic
933508086 2:83204112-83204134 CTGGAGGAGCTGTGAGAAGAGGG - Intergenic
933766335 2:85711948-85711970 CTGCAGGCGCACAGCGGAGACGG - Intergenic
935155294 2:100479070-100479092 CTCCAGGAGCAGAGTGCTGAGGG + Intronic
935190870 2:100777810-100777832 CTGCAGGAGCAGACTGGATTTGG - Intergenic
935606762 2:104979373-104979395 CAGCGAGAGCAGAGTGAACAAGG - Intergenic
935625438 2:105168782-105168804 CTGCAGGACCACATTCAAGAAGG + Intergenic
936044035 2:109172377-109172399 CTCCAGGAGCAGGGAGAGGACGG - Intronic
936538677 2:113332533-113332555 CAGCCTGAGCAGAGTGATGATGG - Intergenic
937106943 2:119324717-119324739 CTGCAGGAGGGGAGTCGAGAGGG - Intronic
937783670 2:125869842-125869864 TGGCAGGAGCACAGTGAGGAAGG - Intergenic
939014467 2:136886107-136886129 ATGCAGGAGCAGAGTGAACATGG + Intronic
939146529 2:138422034-138422056 CTGCAGAAGCACAGTGCAGAGGG + Intergenic
939321506 2:140628876-140628898 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
939376860 2:141379958-141379980 CTTCAGGAGCAGGCTGAGGAAGG - Intronic
939898094 2:147817083-147817105 CTGCAGCAGCTGCGAGAAGAGGG - Intergenic
940906545 2:159174897-159174919 CAGAAGGAGCTGTGTGAAGAGGG + Intronic
941999398 2:171631043-171631065 GTGCAGGACAAGAGTGAAGCAGG + Intergenic
942181012 2:173380749-173380771 CTTCAAGAGAAGAATGAAGAGGG - Intergenic
942228098 2:173834569-173834591 GAGCAGGAGCAGAATGAAAATGG + Intergenic
942248621 2:174029174-174029196 CTGCAGAAGGTGATTGAAGAGGG + Intergenic
942312979 2:174672730-174672752 CTGCAGGAACAGGGAGAAGATGG - Intronic
944402289 2:199341931-199341953 CTGCAGGACCAGGCTGAAGCTGG - Intronic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
944634106 2:201657832-201657854 GAGCATGAGCAGGGTGAAGAAGG - Intronic
946364681 2:219241623-219241645 TGGCTGGAGCAGAGTGAACATGG + Intronic
946884361 2:224208339-224208361 CTGCTGGAGCAGTGTGAGCAAGG + Intergenic
947071031 2:226288050-226288072 CTTAAGGAAGAGAGTGAAGAAGG - Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947932943 2:233978979-233979001 CTGAAGAAGCAGAGTGATGTGGG + Intronic
948187804 2:236035037-236035059 CTGCAGGCGCATTGTGAGGAAGG + Intronic
948257945 2:236581653-236581675 ATGCTTGAGTAGAGTGAAGAGGG + Exonic
948684604 2:239662523-239662545 ATGGAGGAGCAGAGTGGAGAGGG - Intergenic
948716906 2:239871023-239871045 CTGAAGGAGCGGAGGGGAGAGGG + Intergenic
948927517 2:241108795-241108817 CTGCAGGACGAGACTGAACAGGG + Intronic
1169425927 20:5497402-5497424 CAGCAGGAACTGAGAGAAGAAGG + Intergenic
1169482841 20:6000967-6000989 CTGCAGGACCAGAGGGAAACAGG + Intergenic
1169794186 20:9443620-9443642 CTGCAGGATCAGACTGAGGCTGG + Intronic
1169993064 20:11525069-11525091 CAGCTGGAGCAGAGGGAATAAGG + Intergenic
1170607564 20:17885210-17885232 CTGCTGGACCAAATTGAAGATGG - Intergenic
1170857891 20:20074279-20074301 CTGCAGAAGAAGAGAGAACACGG - Intronic
1171311139 20:24145500-24145522 CTGCAAGTGCACACTGAAGAGGG - Intergenic
1171340690 20:24425245-24425267 CTGCAGGAACACAGTGGAGATGG + Intergenic
1171449143 20:25224055-25224077 CTGCAGGAGCACTGTGAGGTTGG - Intronic
1171877708 20:30593827-30593849 CTGCAGGAGCTGGGTGGGGAAGG + Intergenic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1172227040 20:33311966-33311988 ATAAAGGAGCAGAGAGAAGAAGG - Intergenic
1172314566 20:33943758-33943780 CTGGAGGAGTGGAGTGATGATGG + Intergenic
1172361624 20:34316624-34316646 CCGTAGGAGCAGAGAGAAGGAGG + Intergenic
1172951888 20:38727569-38727591 CTGTACGAGGAGAATGAAGACGG + Exonic
1173274335 20:41566502-41566524 CCACAGGAGCAGAGTGGGGAAGG - Intronic
1173664190 20:44753439-44753461 CTGGAGAAGGAGAGTGGAGATGG + Intronic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174975050 20:55323664-55323686 CTACAAGAGCAGAGTTAAGCAGG + Intergenic
1176134340 20:63514655-63514677 CAGCAGGAAGAGAGTGAAGGGGG + Intergenic
1176369175 21:6052265-6052287 CTGCAGCAGCAGAGGGCAGCTGG + Intergenic
1176901611 21:14449053-14449075 CAGTAGGGGCAGAGTGAGGAGGG - Intergenic
1177197601 21:17919284-17919306 CTGCAGGGGCAGAGTGCTCATGG - Intronic
1177473121 21:21584256-21584278 CTACAGGAGCTGTGAGAAGAGGG + Intergenic
1178748217 21:35274223-35274245 GAGCAAGAGCAGAGTGAACAAGG - Intronic
1179754344 21:43486276-43486298 CTGCAGCAGCAGAGGGCAGCTGG - Intergenic
1179991494 21:44950486-44950508 CTGCAGGAGCGCAGGTAAGAAGG - Intronic
1180863897 22:19104887-19104909 CAGCAGCAGCAGAGGGGAGAAGG + Intronic
1180926120 22:19556165-19556187 CTGCAGGGCCAGAGGCAAGATGG - Intergenic
1181621429 22:24094138-24094160 CTGCAGGAACAGAGAGGAGCTGG + Intronic
1181845903 22:25708369-25708391 GTGCAGGAGCAGTGCGGAGAGGG + Intronic
1181854436 22:25772089-25772111 GTGCAGGACCACAGCGAAGAGGG + Intronic
1182252104 22:29009075-29009097 CTGCAGGGCCACTGTGAAGAGGG + Intronic
1182358821 22:29734936-29734958 CCGCGGGAGCAGAGGGAAGGTGG + Intronic
1182510108 22:30813589-30813611 CTGCAGCAGCTGGGTGAGGATGG - Intronic
1182786397 22:32911431-32911453 AGGCAGGAGAAGAGTCAAGATGG - Intronic
1184027711 22:41870267-41870289 CAGCAGGAGCAGAGCAGAGATGG - Intronic
1184345516 22:43910316-43910338 CTGCAGAAGCAGAGGGCAGGGGG - Intergenic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
1185276996 22:49954081-49954103 CCGCAGGAGGAGAGTGTGGAAGG + Intergenic
1185344915 22:50306936-50306958 CTGCAGGAGCAGGGTGCGGAGGG + Intronic
949147885 3:725565-725587 CTGCAAGGGCAGAGTGAAGAGGG - Intergenic
949426194 3:3918729-3918751 CTGTAAGAGCAGAGTGAAGCAGG + Intronic
949654967 3:6207265-6207287 CTGGAGAAGCATGGTGAAGATGG - Intergenic
950436530 3:12983627-12983649 CTGAAGGAGCTGAGCCAAGAAGG - Intronic
950494282 3:13324376-13324398 CGGCAGGAGCACTGTGAGGAAGG - Intronic
952317721 3:32246206-32246228 ATGCAGGATCAGGGTGGAGAGGG - Intronic
952333694 3:32387021-32387043 CCACAGGAGCTGAGTGAGGAAGG - Intergenic
952461925 3:33536527-33536549 TGGCAGGAGCAGAGTGAACAAGG + Intronic
952914424 3:38222477-38222499 CTGCAAGAGCAGAGTGGGGAGGG + Intronic
953504668 3:43473320-43473342 ATCCAGGAGGAGAGTGTAGACGG - Intronic
954256758 3:49412536-49412558 CAGCAGCAGCAGCTTGAAGAGGG - Exonic
956576692 3:70760047-70760069 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
956697089 3:71927810-71927832 TTGGAGAAGCAAAGTGAAGATGG - Intergenic
958055040 3:88399421-88399443 ATGCAGGAGCAGAGTGAGTGAGG - Intergenic
958502458 3:94930967-94930989 CTTCAAGAGGAGATTGAAGAGGG - Intergenic
959385525 3:105701028-105701050 CTCCATCAGCAGAGGGAAGATGG + Intronic
959557091 3:107733040-107733062 CAGTATGAGCAGAGTGGAGACGG - Intronic
961171732 3:124802061-124802083 CTGCAGGAGCCCAAGGAAGAAGG - Intronic
961232862 3:125334847-125334869 CTGCTGGAGTGGAGTGAACAAGG - Intronic
961319712 3:126064220-126064242 CCACAGGAGCAGAGTCAGGAGGG - Intronic
962020581 3:131496974-131496996 CTGCAGAAGCAGAGACAACATGG - Intronic
962707847 3:138062456-138062478 CTGCAGGAACACTGTGGAGATGG - Exonic
962808430 3:138943065-138943087 CGGCAGGAGCAGGATGGAGAGGG - Intergenic
965158031 3:165089524-165089546 GAGCAGGAGCAGAGAGAAGAAGG + Intergenic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
966418955 3:179718675-179718697 CTTCAGGTGCACAGTGAAGTTGG - Intronic
966851223 3:184166320-184166342 CTGAAGGAGCAGGGTACAGATGG - Intronic
966863552 3:184243814-184243836 CAGCAGGAGCAGGGTGAGGTGGG + Exonic
968449857 4:670023-670045 CTGCAAGAGAAGACAGAAGATGG - Intronic
968585526 4:1414465-1414487 CTGCAGGAGGTGGGTGGAGATGG + Intergenic
968585567 4:1414587-1414609 CTGCAGGAGGTGGGTGGAGATGG + Intergenic
968646162 4:1741629-1741651 CTGCAGGTGCAGCTGGAAGAGGG + Intronic
969082734 4:4632340-4632362 CTGTAGGAGAAGAGGGAAAAGGG - Intergenic
969276698 4:6140535-6140557 CTGCAGGGTCAGAGGGAAGTCGG + Intronic
969325554 4:6441935-6441957 CTGCAGGAGTAGGGCGGAGAAGG - Intronic
969523851 4:7694129-7694151 CTGCAGGGGCAGAGGAAGGATGG + Intronic
969525443 4:7701793-7701815 ATGGAGGGGCAGAGGGAAGACGG + Intronic
970329411 4:14963662-14963684 TTGCAGGGTAAGAGTGAAGAGGG + Intergenic
970594391 4:17586633-17586655 CTGCAGGATCAGAGGGATGAGGG + Intronic
971183092 4:24349312-24349334 CTGCAGTAGTAGTGTGGAGAGGG + Intergenic
971425977 4:26515902-26515924 CCACAGGAGAAGAGTGAAGATGG + Intergenic
971426104 4:26517262-26517284 CCACAGGAGAAGAGTGAAGATGG - Intergenic
973576251 4:52292335-52292357 CAGCAGGAGCAGAGTCACTAGGG - Intergenic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
973911515 4:55586112-55586134 CAGCAGAAGCAGATTTAAGAGGG - Intronic
975119971 4:70717681-70717703 CTGAAGTTGCAGAGTGTAGAAGG + Intronic
975363899 4:73505449-73505471 CTGAAGGTGCAGAGTGAGAAAGG + Intergenic
977983973 4:103360377-103360399 CTGCAGGGGCAGAGTGCTCATGG + Intergenic
978223110 4:106301390-106301412 GTTTAGAAGCAGAGTGAAGATGG - Intronic
978247738 4:106595292-106595314 CAGAAGAAGCAGAGTGAATAGGG - Intergenic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
980418427 4:132524091-132524113 ATGGAGGAACAGAGTGAAGGAGG - Intergenic
980467224 4:133201934-133201956 CTTTGGGAGCAGAGTGAAGAAGG + Intronic
981282847 4:142979421-142979443 CAGTAAGAGCAGAGTGAAGCAGG + Intergenic
982209083 4:153020496-153020518 GTGCAGGAGGAGAGTGGGGAAGG - Intergenic
982722261 4:158870740-158870762 CTGCAGGAGCAGTGAGGAGGGGG + Intronic
982900916 4:161002527-161002549 ATCCAGGTGCAGAGTGAGGAGGG + Intergenic
985061277 4:186081836-186081858 CTGCAGGAACCGAGTAAGGAAGG + Intronic
985478797 5:94434-94456 GAGCAGGGGGAGAGTGAAGAGGG + Intergenic
985478831 5:94547-94569 GGGCAGGGGGAGAGTGAAGAGGG + Intergenic
985564966 5:611161-611183 ATGCAGGAGGAGTGTGCAGAGGG - Intergenic
985924415 5:3004696-3004718 CTGCAGGAAAAGCGGGAAGAGGG + Intergenic
986645093 5:9909426-9909448 CCACTGGGGCAGAGTGAAGAAGG + Intergenic
988194443 5:27984760-27984782 CAGGAGGAGGAGAGTGAAGCAGG + Intergenic
988372665 5:30391723-30391745 GTGCAGGAGAGGAGTTAAGATGG - Intergenic
988473847 5:31565504-31565526 CTACTGGAGCTGAGAGAAGAGGG - Intergenic
989322359 5:40151199-40151221 CTGGAGGAGCAAAAGGAAGAAGG - Intergenic
989408684 5:41091838-41091860 CTGAATGAGCTGACTGAAGAAGG + Intergenic
990986154 5:61642668-61642690 CTTCAGGATAAGAGAGAAGAAGG - Intronic
991126487 5:63075513-63075535 CTGCAGCAGCATATGGAAGATGG - Intergenic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
993139127 5:84008146-84008168 TTGCAGGAGTAAAGTGAGGATGG + Intronic
993837406 5:92832633-92832655 CTGCTAGAGCAGTGTTAAGAGGG - Intergenic
994879795 5:105475514-105475536 CTGTTGGAGCACATTGAAGAGGG + Intergenic
995250214 5:109984568-109984590 CAGGAGGAACAGAGTGAAGGGGG - Intergenic
995320742 5:110830852-110830874 CTCCATCAGCAGAGAGAAGAGGG - Intergenic
995545982 5:113231548-113231570 CTGTAGGAACAAAGTGAACATGG - Intronic
995758625 5:115540250-115540272 CTTCAGGATCAGAGTGGAGGAGG + Intronic
996286186 5:121795756-121795778 CTGCAGGAGCACAGTGGGGGAGG + Intergenic
996307192 5:122060796-122060818 CTGCAGGAGCAGATGGAACCAGG - Intronic
996487510 5:124054398-124054420 GTGCAGGAGTAGAGTCTAGAAGG + Intergenic
996698470 5:126424124-126424146 CTTCAAGAGCAGAGTGGGGATGG + Intronic
997415669 5:133726479-133726501 CTTCTGGAGGAGAGTGAGGATGG - Intergenic
997470863 5:134115960-134115982 ATGCATGAGCAGATTGAAGGCGG - Exonic
997716388 5:136046312-136046334 CTGCAGGAGCAGAAGACAGAAGG - Intronic
998269598 5:140694693-140694715 CAGCAGGAGCTGAGTAGAGATGG - Intronic
998354795 5:141526021-141526043 ATGCAGGTGAGGAGTGAAGACGG - Exonic
999193080 5:149763148-149763170 CTGCAGGGCCAGAGTGGGGAGGG - Intronic
999283069 5:150377451-150377473 CTGGAAGAGCTGAGAGAAGATGG + Intronic
999380358 5:151117164-151117186 CTGCAGGGGCATCGTGAGGAGGG - Exonic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1001917181 5:175571590-175571612 ATGCAGGAGCAGGGAGAGGAAGG - Intergenic
1002775900 6:327322-327344 CAGCTGGAGGAGAGTGAAGGTGG + Intronic
1002952475 6:1828340-1828362 CAGAAGAAGCAGAGAGAAGAAGG + Intronic
1003007924 6:2398610-2398632 CTGCAAGACCAGAGTGACGGAGG + Intergenic
1003477910 6:6501811-6501833 CTGCAGCAGCTGACAGAAGATGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1005080442 6:21951917-21951939 GTGGAGGAGGAGAGTGGAGATGG + Intergenic
1005348009 6:24909452-24909474 CTGGAGGAGCAAGGGGAAGAGGG + Intronic
1005973596 6:30780254-30780276 CTGAAGGCCCAGAGTGAACAGGG - Intergenic
1006191132 6:32210267-32210289 TTGCTGGAGCAGAGAGTAGAAGG + Intronic
1006554867 6:34857359-34857381 CTGCAGGAAAGGAGTGTAGATGG - Exonic
1006811262 6:36821931-36821953 TTGCATGAACAGACTGAAGATGG - Intronic
1006926962 6:37661852-37661874 GTGCAGGAACAGATTGAAGGGGG + Intronic
1007417736 6:41701991-41702013 CTGCAAGAGCACAGTGAAGTGGG + Intronic
1007478862 6:42136915-42136937 GGGGAGGAGCAGAGTGAACAGGG + Intronic
1007918097 6:45579816-45579838 CTGCAGAAGCAGAGTAGAGCAGG + Intronic
1008418322 6:51268709-51268731 CTGGAGGAACAGGGGGAAGAGGG - Intergenic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1009242467 6:61198874-61198896 CTGCAGGAGCAGAGTCCTCATGG + Intergenic
1009478614 6:64126684-64126706 TTGCAGGAAGACAGTGAAGAGGG - Intronic
1010133530 6:72523339-72523361 CTGGTGGAGGAGAGTAAAGAGGG + Intergenic
1010602428 6:77846674-77846696 CTCCAGCAGAGGAGTGAAGATGG - Intronic
1010824222 6:80453240-80453262 CTGAAGCAGCAAAGAGAAGATGG + Intergenic
1011621853 6:89250671-89250693 TTCCAGGAGCCCAGTGAAGAAGG - Intergenic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1013070399 6:106723946-106723968 TGGCTGGAGTAGAGTGAAGAGGG + Intergenic
1013335943 6:109161378-109161400 CTGCTGGAGCAGAAAGCAGAGGG + Intronic
1013856367 6:114578478-114578500 TTCAAGGAGCAGAGTAAAGAAGG + Intergenic
1014429500 6:121350831-121350853 CTACATAAGCAGAATGAAGAGGG + Intergenic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015809084 6:137143225-137143247 GTGCTGGAGAAGAGTGAGGAAGG + Intergenic
1015890795 6:137967913-137967935 CTGGAGCATCAGAGTGATGATGG - Intergenic
1015970702 6:138740439-138740461 CTTCAGCAGCAGCGTGAAAACGG - Intergenic
1016340866 6:143060632-143060654 ACGCAGGAGCAGAATGACGAAGG + Intronic
1017584376 6:155904187-155904209 CTGCATGAGCATGGTGGAGAAGG + Intergenic
1017894560 6:158668114-158668136 CAGTAAGAACAGAGTGAAGATGG + Intronic
1018169235 6:161131315-161131337 CTGCAGGAGCTGAGGAAGGAAGG + Exonic
1018180195 6:161216585-161216607 CTTCAGCAGCAGTGTGAAAACGG - Intronic
1018304844 6:162444138-162444160 CAGCAGGTGCAGTGAGAAGACGG - Intronic
1018385638 6:163300477-163300499 CTGCAGGAAGAGAGTGAGGGCGG - Intronic
1019050597 6:169180127-169180149 CTGGTGGAGCAGTGAGAAGAGGG - Intergenic
1019099871 6:169620837-169620859 CTGGAGGAGCAGAGTACAGGAGG - Intronic
1019099876 6:169620879-169620901 CTGGAGGAGCAGAGTGCAGGAGG - Intronic
1019861491 7:3662537-3662559 CTGGAGGTCCAGAGAGAAGAAGG + Intronic
1021242398 7:18219860-18219882 AGGCAGGAGCAGAGTGTAGCAGG + Intronic
1021281898 7:18730224-18730246 GTGGAATAGCAGAGTGAAGATGG - Intronic
1022108832 7:27215376-27215398 AAGGAGGAGGAGAGTGAAGAAGG - Intergenic
1022283489 7:28933560-28933582 CTGCCGGGGAGGAGTGAAGAAGG + Intergenic
1022298189 7:29077147-29077169 CTGGAGGAGCTGATTGAAGCTGG - Intronic
1023587384 7:41744695-41744717 CTGCAGGGGCCCAGTGGAGAGGG - Intergenic
1023641638 7:42264885-42264907 GTGCAGGAGGAGAGTGAGAAAGG + Intergenic
1024604144 7:51011041-51011063 CTGATGGAGCAGAGGGCAGACGG - Intergenic
1024845481 7:53636880-53636902 CTAATGGAGCAGAGAGAAGAAGG + Intergenic
1027226219 7:76245258-76245280 TTGAAGGAGCAGAGGGAAGCAGG + Intronic
1027269369 7:76511634-76511656 CTGCAGGAGGAGAGAACAGATGG - Intronic
1027292178 7:76726088-76726110 TAGCAGGTGCAGAGTCAAGAAGG - Intergenic
1027320080 7:77005527-77005549 CTGCAGGAGGAGAGAACAGATGG - Intergenic
1027800924 7:82747850-82747872 CTGGAGGATCAGAGACAAGAAGG + Intergenic
1030109239 7:106012486-106012508 TGGCAGGAGGAGAGTGAACAAGG + Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1031360646 7:120844828-120844850 CTAGTGGAGCAGTGTGAAGAGGG - Intronic
1031492509 7:122406462-122406484 CTGCAGGAAGACAGGGAAGAAGG + Intronic
1031931486 7:127690388-127690410 CTGCATGAGCTGAGGGCAGAAGG - Intronic
1032531605 7:132625288-132625310 CTGAAGGAGCAGAATTATGAAGG + Intronic
1032715211 7:134503323-134503345 CTCAAGGAGCAGAGTGAAGCTGG + Intergenic
1033933007 7:146547494-146547516 TTCCAGGAGCTGAGGGAAGAGGG - Intronic
1034010427 7:147523617-147523639 CTGCAGAAGCAGAGAGGAGGAGG - Intronic
1034212031 7:149372431-149372453 CAGGAGGAAGAGAGTGAAGAAGG + Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034970026 7:155413089-155413111 CTCCAGCAGCAGGGTGAGGAAGG + Intergenic
1035125588 7:156606676-156606698 CTGCCGGAGCCGAGAGATGAGGG - Intergenic
1035332502 7:158105487-158105509 CTGCTGTAGCTGAGTGGAGATGG - Intronic
1035427225 7:158787122-158787144 CTGCAGGAGCCCAGGGAAGGAGG + Intronic
1036070170 8:5433929-5433951 CTGCAGGAGCAGCATTGAGAAGG + Intergenic
1036398891 8:8390881-8390903 TTGCAGGAGTATTGTGAAGAAGG + Intergenic
1036616853 8:10394706-10394728 CTGCTGGGGCAGAGTGCAGAAGG - Intronic
1037290527 8:17345223-17345245 CTGCAGGAGCAGAGCGTGGCAGG - Intronic
1038272235 8:26084596-26084618 CCCCAGGAGCAGAGTGCAGAGGG + Intergenic
1039095571 8:33881022-33881044 GTGTAGGAGCTGAGTGAAGCCGG - Intergenic
1040094911 8:43433871-43433893 CTGCAGGGGCAGGGTGATCATGG + Intergenic
1040391578 8:46954948-46954970 CTGCAGGAGGAGGGTGAGGCCGG + Intergenic
1040889472 8:52301996-52302018 GAGCCAGAGCAGAGTGAAGATGG + Intronic
1041330480 8:56719109-56719131 GGGCAGGAGGAGAGGGAAGAGGG - Intergenic
1041741361 8:61160483-61160505 CTGCAGGAGCAGAAGGAAAATGG + Intronic
1042497412 8:69470645-69470667 CTGCAGTAGTAGACAGAAGAGGG - Intronic
1042609480 8:70581940-70581962 GTGCCGGAGCAGAATGAAGGGGG + Intronic
1043613192 8:82091753-82091775 CTGCTGGATAAGGGTGAAGAAGG + Intergenic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1044793171 8:95868739-95868761 CTGCAGGAGAAGGCAGAAGAAGG - Intergenic
1044900021 8:96934368-96934390 CTGGGGGAGCTAAGTGAAGAGGG + Intronic
1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG + Intronic
1045260782 8:100571552-100571574 CTGCAGGTGCTGGGAGAAGATGG - Intergenic
1045362152 8:101442658-101442680 CTGCAGGAAGAGGGTGCAGATGG - Intergenic
1045431861 8:102122525-102122547 CAGCAGGAACTGAGAGAAGAGGG + Intronic
1045521267 8:102905100-102905122 CTCCAGGAGCAGCGTGCAGCTGG - Intronic
1046877035 8:119266584-119266606 GTGTAGGAGCAGAATGAAGGAGG + Intergenic
1046957156 8:120073516-120073538 CTGAAGATGCAGTGTGAAGAGGG - Intronic
1047025362 8:120817795-120817817 CTGCTGGAGCAGAGAGGAGTGGG - Intergenic
1047151494 8:122268595-122268617 CTGATGGAGCAGAGTGCAGGGGG + Intergenic
1047277291 8:123416161-123416183 CTGCGGGAGCCCAGAGAAGAGGG - Intronic
1047981822 8:130191332-130191354 CTGCAGGAGCAGATTATAGATGG + Intronic
1048561085 8:135538221-135538243 CTGCTGGTTCAGATTGAAGATGG + Intronic
1048668557 8:136691348-136691370 CAGCTGGAGCAGAGTGTACAGGG - Intergenic
1048685551 8:136901215-136901237 CTGCAGGAGCACCATCAAGATGG + Intergenic
1048703857 8:137127037-137127059 CTGCTGGAGCAGAGTAAACCAGG + Intergenic
1048718123 8:137291194-137291216 CTGAAGGAGCAGATTGAAGTAGG - Intergenic
1048941464 8:139404138-139404160 GTGCAGAAGCAGAGTGATGTGGG + Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049382037 8:142321009-142321031 ATGCAGGATCAAAGTGAACAAGG + Intronic
1049592062 8:143467086-143467108 CTGCAGCCGCAGAGGGGAGAGGG + Intronic
1049614924 8:143571919-143571941 TGGCAGGAGCAGCCTGAAGATGG + Intronic
1049764906 8:144350627-144350649 CTGCAGGAACAGCCTCAAGAAGG - Intergenic
1050405926 9:5308746-5308768 TTGCAGGAGCAGAGTGAGGGAGG - Intergenic
1050577434 9:7011848-7011870 CGGCATGAGCAGAGTGCAGATGG - Exonic
1051300312 9:15643733-15643755 TTGCAGGAGGATAGGGAAGAAGG - Intronic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1052778289 9:32755043-32755065 CTGCAGGAGCTCAGAAAAGAAGG - Intergenic
1053193739 9:36098037-36098059 CAGGAGGAGGAGAGAGAAGAGGG + Intronic
1053831428 9:42086003-42086025 CTTCATCAGCAGTGTGAAGATGG - Intronic
1055293641 9:74811883-74811905 ATGCTGGAGAAGAGTGCAGAAGG + Intronic
1055673161 9:78627410-78627432 CTGCAAGAGCAGAGGGGAGAGGG - Intergenic
1056295242 9:85186516-85186538 CTGCAGACGGAGAGTGAAGCAGG - Intergenic
1056577761 9:87869089-87869111 CTGTAGGAGAAGAGAGAAGATGG + Intergenic
1056841361 9:90000220-90000242 CTGCAGGAGCAGCAGGGAGAGGG - Intergenic
1056937949 9:90932152-90932174 ATTCAGGAACAGAATGAAGAGGG + Intergenic
1057241044 9:93409556-93409578 CAGCAGGAGGAAAGTGAGGATGG - Intergenic
1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG + Intergenic
1057270456 9:93647387-93647409 CTGCAGAAGCAGGGAGGAGATGG + Intronic
1057641959 9:96833062-96833084 CAGCAGCAGAAGAGAGAAGACGG - Intronic
1057667800 9:97059919-97059941 CTGCAGATCCAGAGTGAAGCTGG + Intergenic
1057901796 9:98954917-98954939 ATGAAGGAGAAGAGTGGAGAGGG - Intronic
1058040721 9:100298644-100298666 CTGGAGGAACAGAGTGCAGCTGG + Intronic
1058647621 9:107145318-107145340 GGGCAGGAGCAAAGTGAAGGAGG + Intergenic
1059570059 9:115424949-115424971 CTGCTGGAGCTGTGAGAAGAAGG - Intergenic
1060054693 9:120403409-120403431 GTGCAACAGCAGAGTGATGAAGG + Intronic
1061935529 9:133855486-133855508 CTGCAGGAGCAGAGGCTAAAAGG + Intronic
1062095239 9:134699742-134699764 CTGCAGGAGCAGTTTGATCAAGG + Intronic
1062517913 9:136945343-136945365 TGCCAGGAGCAGAGTCAAGAGGG - Exonic
1203492339 Un_GL000224v1:118981-119003 CTGCAGGAGCTGGGTGGGGAAGG + Intergenic
1203504962 Un_KI270741v1:60853-60875 CTGCAGGAGCTGGGTGGGGAAGG + Intergenic
1185713026 X:2319245-2319267 CTGCAGGAGTAGGGAGAGGAGGG - Intronic
1185956456 X:4496115-4496137 TTGAAGGAGCAAATTGAAGATGG + Intergenic
1186855707 X:13624164-13624186 CAGCAGCAGGAGAGTGAATATGG - Intronic
1187217013 X:17287012-17287034 CTTCAGGAGCAGGGTAAAGCAGG + Intergenic
1187777269 X:22775380-22775402 CTGCAAGACTAGAGTGGAGAGGG - Intergenic
1188168846 X:26895618-26895640 CAGCAAAAGCAGTGTGAAGAGGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188828618 X:34868372-34868394 TGGCAGGAGGAGAGAGAAGAGGG + Intergenic
1189178736 X:38983117-38983139 AAGGAGGAGGAGAGTGAAGAGGG + Intergenic
1190217468 X:48489446-48489468 GGGCAGGAGCAGAGTGAACAAGG + Intergenic
1190321490 X:49182468-49182490 CTGCTGGCGCAGAGTGAGCAAGG - Intronic
1190393838 X:49959873-49959895 TTGCTGAAGCAGAGTGAAAATGG - Intronic
1191724069 X:64260308-64260330 CAGGAGCAGGAGAGTGAAGAGGG - Intergenic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1192322081 X:70098119-70098141 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
1192680344 X:73247324-73247346 CTGCATCAGCAGTGTGAAAATGG + Intergenic
1192779432 X:74278889-74278911 ATGCCAGGGCAGAGTGAAGAAGG + Intergenic
1194886130 X:99318348-99318370 CTGCAGGAGCAGAGCCATCATGG + Intergenic
1194938328 X:99978916-99978938 CAGCATGAACAGGGTGAAGAGGG - Intergenic
1195570837 X:106397001-106397023 CTGCAGGCACCGAGTGGAGAGGG + Intergenic
1195903206 X:109819529-109819551 CTGAGGGAGCACAGGGAAGATGG + Intergenic
1196086299 X:111685911-111685933 TTGCAGGAGCATAGTGAGCAAGG + Intronic
1198176116 X:134156637-134156659 GTGCAGGAGCAGAGAAAAGGGGG + Intergenic
1198815630 X:140587135-140587157 CTGCAGAAGCAGAGCGCAGGAGG + Intergenic
1199363484 X:146949728-146949750 TTGCAGGAGGAGATTGCAGATGG + Intergenic
1199400740 X:147395637-147395659 CTGCTGGAGCTGTGAGAAGAGGG + Intergenic
1199424022 X:147680435-147680457 CTGCAGGAGCAGAGTAGGGAGGG + Intergenic
1199692862 X:150321905-150321927 CTGCAGGAGCAGACCAAAAAAGG + Intergenic
1200279790 X:154767163-154767185 CTGCAGCAGCCGACTGAAAAGGG - Intronic
1201140839 Y:11026745-11026767 GTGCTGGAGAAGAGTGGAGAGGG - Intergenic
1201600840 Y:15727304-15727326 TTTCAGGAGCTGAGAGAAGAAGG - Intergenic