ID: 1008708470

View in Genome Browser
Species Human (GRCh38)
Location 6:54193867-54193889
Sequence TGCAGGGAAAAAGACCCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008708470_1008708474 8 Left 1008708470 6:54193867-54193889 CCAGCGGGGTCTTTTTCCCTGCA 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1008708474 6:54193898-54193920 CACACAAGTTAGGCACCCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 69
1008708470_1008708473 -2 Left 1008708470 6:54193867-54193889 CCAGCGGGGTCTTTTTCCCTGCA 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1008708473 6:54193888-54193910 CATAAGATAACACACAAGTTAGG No data
1008708470_1008708475 22 Left 1008708470 6:54193867-54193889 CCAGCGGGGTCTTTTTCCCTGCA 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1008708475 6:54193912-54193934 ACCCCAAGGTAGCTAAACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008708470 Original CRISPR TGCAGGGAAAAAGACCCCGC TGG (reversed) Intronic
907518475 1:55008190-55008212 TGCAGGGACAAAGACCACAAGGG - Intronic
908526881 1:64996668-64996690 TGCTGGGAAAAAATCACCGCAGG - Intergenic
908974187 1:69878006-69878028 GGCAGGGAAAAAGAGTCAGCTGG + Intronic
917020659 1:170582915-170582937 TGGAGGGAAAAAGAGCTCTCAGG - Intergenic
921411359 1:214839596-214839618 GACAGGGAAAGAGACTCCGCAGG - Intergenic
921562015 1:216670519-216670541 TGAAGGGAAAAAAGCCCAGCTGG + Intronic
922244127 1:223778198-223778220 GGGAGGGAAAAAGACCACTCTGG - Intergenic
922663148 1:227447564-227447586 AGCAGGGAGAAAGGCCCCGGTGG + Intergenic
1063244608 10:4205308-4205330 TGCAGGTAAAAGGGCCCCACAGG - Intergenic
1064453585 10:15465996-15466018 TCCAGAGAAAAAGAACCAGCAGG - Intergenic
1069554548 10:69389305-69389327 TGCAGGGAAAGAGACCTTCCAGG - Intronic
1072518574 10:96210545-96210567 TGCAGGGGACAAGACCCTTCGGG - Intronic
1074946355 10:118284474-118284496 TGCAGGGAAAAAAACCGCCCTGG + Intergenic
1076146474 10:128126243-128126265 TGCAGCGAACGCGACCCCGCGGG - Exonic
1076601912 10:131662834-131662856 AGCAGGGAAAAAAACCCCTGAGG - Intergenic
1081391135 11:42530211-42530233 AGCAGGGGAAAGGACCCAGCTGG - Intergenic
1083520826 11:63311130-63311152 TGTAGGGAAAAAAACCCTTCTGG - Exonic
1083990896 11:66245095-66245117 TGCAGAGGCAAAGACCCCACTGG - Intergenic
1091372145 11:135069941-135069963 TGCAGAGAAACAGACCCAACAGG - Intergenic
1091601938 12:1923036-1923058 AGCAGGGACAAACAGCCCGCAGG - Intergenic
1095736210 12:45559126-45559148 TGCAGTGAACAAGATCCCTCAGG + Intergenic
1096073707 12:48789331-48789353 TTCTGGGATCAAGACCCCGCGGG + Intergenic
1100282012 12:93127253-93127275 TGCAGGGAAAATGACCTATCTGG + Intergenic
1103263294 12:119608129-119608151 TGCAGGCTAAAAAACCCCACTGG - Intronic
1104900939 12:132189229-132189251 TGCCGGGAGACAGACCCCGGAGG - Intergenic
1107892896 13:44929992-44930014 TGCAGGGAAGATGGCCCCACTGG - Intergenic
1108938367 13:55915617-55915639 TGAAGAGAAAAAGACCCCAGTGG + Intergenic
1110047657 13:70850806-70850828 TTAAGGGAAAAGGACCCCACTGG - Intergenic
1110324865 13:74202216-74202238 TGCAGGGAGAAAGACACAGAGGG + Intergenic
1110840152 13:80132933-80132955 TACAGGGAAAAAGAGCGAGCGGG + Intergenic
1112440678 13:99422569-99422591 TGCAGGGAGAAAAACACCGCTGG - Intergenic
1119861366 14:77938412-77938434 TGCAAGGAAAAGGACACGGCAGG - Intergenic
1124617276 15:31250757-31250779 TGCAGAGAAGAAGACCACTCTGG - Intergenic
1125789317 15:42351338-42351360 TGCTGGGATAATGACCCCTCTGG - Exonic
1129118697 15:73381591-73381613 TTCAGGGAGAGAGACCCCGTGGG - Intergenic
1130859194 15:87871462-87871484 TGCAGGGAAAACCACCCCCTAGG - Intronic
1131293536 15:91127993-91128015 TGCAGAGAAAAACATCCCTCAGG + Intronic
1132414024 15:101607882-101607904 GGCAAGGAAACAGACCCCCCTGG + Intergenic
1133045540 16:3086614-3086636 TGCAGGGCCAAAGTCCCCTCAGG - Intergenic
1135681838 16:24463935-24463957 TGCAGGGAGAAACACTCCACTGG + Intergenic
1136528685 16:30851126-30851148 TGCAGGGAAAACGAACCAGTAGG - Intronic
1141095478 16:81159901-81159923 GGCAGGGAAGCAGACCCTGCCGG + Intergenic
1143188018 17:5022282-5022304 TGCAGGGCAAAGACCCCCGCTGG + Exonic
1143224409 17:5288311-5288333 TCTAAGGAAAAAGACCCCTCAGG - Intronic
1149033796 17:52112452-52112474 AGGTGGGAAAAAGACCACGCTGG + Intronic
1151268638 17:72976504-72976526 TGCTGGGAAAATGACACCGAGGG + Intronic
1154214846 18:12408256-12408278 TGCAGGCACAGAGGCCCCGCTGG + Intronic
1157008003 18:43609673-43609695 TGTAGGGAAAGAGCCCCCACAGG + Intergenic
1160879653 19:1313585-1313607 TGCAGGGAGAGAGACACGGCCGG + Intergenic
1164778265 19:30871749-30871771 TGGAGGTGAAAAGACCCCGCTGG - Intergenic
1165040297 19:33064041-33064063 TGGAGGCAAAAAGAGACCGCCGG + Intronic
1167064756 19:47176560-47176582 TGCAGGCAAAAGGACCCTGTGGG - Intronic
1167569505 19:50278091-50278113 TGCATGGGAGAAGACCCGGCTGG + Exonic
1168720606 19:58552712-58552734 TGGAGGGAAAAGGAACCCTCAGG - Intronic
925248068 2:2402426-2402448 TCCAGGGAGAAGGACCCCTCTGG - Intergenic
928932222 2:36636506-36636528 AGCAGGCAAAAAGAACCTGCTGG - Intronic
932572937 2:72947428-72947450 TGCAGTGAGAAGGTCCCCGCCGG + Intronic
934611590 2:95741614-95741636 TGCAAGAAAACAGATCCCGCTGG - Intergenic
940388489 2:153103138-153103160 TGCAGGGAAAAAGTCACTGAAGG - Intergenic
945454363 2:210033084-210033106 TGGAGGGAAAAAGACCGCAATGG + Intronic
947004765 2:225498382-225498404 TGAAGGGGAAAAGACCCCAGGGG + Intronic
948784912 2:240347321-240347343 TGCAGGGAAAGAAACCCTCCCGG + Intergenic
1173810997 20:45955411-45955433 TGCAGGGAAATATACCCTACTGG + Intronic
1175254799 20:57634748-57634770 TCCAGGGAAAAAGACTCCACCGG + Intergenic
1182374705 22:29838128-29838150 TGCAGGGCAAGGGACCCCGGAGG - Intronic
1182695796 22:32198684-32198706 TCCAGGGAGAAAGACCCTGGAGG + Intronic
951797232 3:26553104-26553126 TGAAGGGAAAAATATCCCTCAGG + Intergenic
955803681 3:62711590-62711612 TGCAGGGAAAATCACCAAGCTGG - Intronic
973656741 4:53055873-53055895 TGCAGTGAAAATGAGCTCGCTGG + Intronic
978979789 4:114929174-114929196 TCCAGGGAAACAGACCCAGCAGG - Intronic
982661457 4:158212017-158212039 TGCAGGAAAAAAGAAACCACTGG + Intronic
985721814 5:1493476-1493498 TGCATGGAAACAGAGCCGGCAGG + Intronic
986498102 5:8367382-8367404 TGCAGGGAAACCGACCACACTGG + Intergenic
987064141 5:14271415-14271437 TACAGGGAAACAGACTCAGCTGG - Intronic
987253891 5:16128336-16128358 TGGAGGTAAAAGGACCCAGCAGG + Intronic
987258313 5:16179629-16179651 TGCAGGGAAAGAGAGCGCGGAGG + Exonic
996460585 5:123736351-123736373 TGCAGGGGAAATGAACCTGCAGG + Intergenic
1007325023 6:41053212-41053234 TGACGGGAAAAGGACCCAGCAGG - Intronic
1008708470 6:54193867-54193889 TGCAGGGAAAAAGACCCCGCTGG - Intronic
1011756883 6:90509043-90509065 TGAAGGGAAAAATACCCCTGAGG - Intergenic
1018081164 6:160260405-160260427 GGCAAGGAGAAAGACCCCGTGGG - Intronic
1023871634 7:44266490-44266512 GGCAGGGAATAAGACCGAGCTGG - Intronic
1030805440 7:113912552-113912574 TGCAGGGGAAAAGACCTCAAGGG - Intronic
1042246274 8:66712325-66712347 TGCAGGGATCAGGACCCCCCGGG - Intronic
1044260836 8:90118428-90118450 GGCAAGGAAAAAGACACAGCAGG - Intergenic
1044750574 8:95411685-95411707 TGAAGGGAAAAAGACCCCAAGGG - Intergenic
1048267248 8:132998489-132998511 TGCAGGGAAAGAGAGCCCATTGG + Intronic
1050035748 9:1434237-1434259 TGTTGGGAAACAGACCCAGCAGG - Intergenic
1054869990 9:70040354-70040376 TGCAGGGAAAAAGACTGAGGAGG - Intergenic
1060875900 9:127083450-127083472 AGCAGAGAAAGAGACCCTGCAGG + Intronic
1061838567 9:133344706-133344728 TGCATGGAAAAAGGTCCCACAGG - Intronic
1062064721 9:134520128-134520150 TGCAGGGAAAAACACCTGGAAGG - Intergenic
1062261616 9:135665813-135665835 CGCAGGGACAGGGACCCCGCAGG - Intronic
1185627750 X:1494269-1494291 TGCTGGGAAAAAAATCCCACTGG + Intronic
1186611630 X:11143679-11143701 TGGAGGGAAAAAGAATCAGCTGG + Intronic
1198929570 X:141838970-141838992 TTCAGGGAGAAAGCTCCCGCTGG - Intronic